1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa [10]
4 years ago
5

A fishing method called, ____ fishing, uses a large net that encircles the target to catch surface-dwelling species such as tuna

, mackerel, anchovies, and herring, which tend to feed in schools near the surface or in shallow areas.
Biology
1 answer:
Crazy boy [7]4 years ago
5 0
<h2>Purse seine fishing </h2>

Explanation:

Purse-seine fishing in considered to be an efficient form of fishing

  • It has no contact with the seabed and can have low levels of bycatch (accidental catch of unwanted species)
  • A vertical net ‘curtain’ is used to surround the school of fish, the bottom of which is then drawn together to enclose the fish, rather like tightening the cords of a drawstring purse
  • A purse seine is made of a long wall of netting framed with floatline and leadline (usually, of equal or longer length than the former) and having purse rings hanging from the lower edge of the gear, through which runs a purse line made from steel wire or rope which allow the pursing of the net

You might be interested in
What happens to the frequency when the
AVprozaik [17]
A the frenquency increases
3 0
3 years ago
Which bases are found in a strand of DNA
Evgen [1.6K]
If i remember correctly they should be adenine (A), thymine (T), guanine (G) and cytosine (C). i hope this helps. sorry if they arent all correct.
7 0
3 years ago
Read 2 more answers
5 ejemplos de biomoléculas orgánicas y inorganicas
7nadin3 [17]

Answer:

Orgánicas

Colesterol

Agua

Gases

Sales

Minerales

Explanation:

Biomoleculas

Almidón

Azucares

Lípidos

Proteínas

Ácidos Nucleicos

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
if the following mRNA strand were produced during transcription what amino acids would be found in the protein GGCUACGGGCAUCAC
ioda

The correct answer to your question is B. Glycine-Tyrosine-Glycine-Histidine-Histidine.

You can find this by taking groups of codons starting with the first group (GGC). GGC is located under Glycine so Glycine will therfore be an amino acid found in the protein. Continue doing this with the next codons to come up with the answer.

I hope this isn't too late and still helps!

:)

4 0
4 years ago
Other questions:
  • Birds, insects, and many reptiles excrete nitrogenous waste in the form of uric acid, which _____. see concept 44.2 (page 980)
    15·1 answer
  • Which statement describes an advantage of using biometrics for physical access control?
    13·1 answer
  • Quasars are thought to be the centers of distant ____________
    5·1 answer
  • Why are the carbon cycle, the phosphorous cycle, the water cycle, and the nitrogen cycle all considered to be biogeochemical cyc
    9·2 answers
  • How is the nitrogen cycle important to humans?
    9·2 answers
  • Which animal adaptation is well-suited for the canopy of a tropical rainforest?
    11·1 answer
  • What are the polymers of glucose????
    11·1 answer
  • Which structure will form when a primitive cell engulfs an aerobic bacterium? mitochondria chloroplast nucleus cell membrane
    8·2 answers
  • The energy from the sun is produced in the core through the process of nuclear fusion. The photons travel through the sun and ar
    12·1 answer
  • What characteristic of life can you live without out of the 10 main ones
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!