1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
3 years ago
12

How do you tell if the pedigree is recissive ordominant? By the wa the cirlces and squares with all da lines andscribbles are sh

aded.
Biology
1 answer:
Lostsunrise [7]3 years ago
7 0

Answer:

Pedigree analysis is a form of genetic analysis where the geneticist makes a diagram that shows an individual with a characteristic studied and all his known relatives.

The pedigree indicates the presence or absence of this characteristic and if the variation in its expression is applicable.

Mendel's principles still apply.

Example:

  P1 Aa x Aa

  F1 ¼ AA

½ Aa

             ¼ aa

When geneticists are analyzing pedigree, they look for a certain characteristic pattern that will help them determine how the characteristic studied is inherited.

-Auto dominant

The characteristic is expressed in both sexes and no sex is more prone than the other.

Phenotype appears in all generations and each affected person has a parent who suffers from the disease

Person who does not show the phenotype will not transmit the condition to the children.

In families where one of the parents has the gene, there is a 50% chance that any of the children will inherit the condition.

Example autosomal dominant conditions:

Achondroplasia

Neurofibromatosis

Huntington's disease

-Automatic recessive

Both sexes are affected

Although the parents appear to be normal the condition appears in their children in a fraction ¼ (both heterozygous parents).

The characteristic is only expressed when the individual is homozygous recessive.

The probability is higher among consanguineous marriages.

-Linked to dominant x

If a woman is heterozygous (XAXa) for a certain characteristic, we will have that 50% of her sons and 50% of her daughters are expected to inherit the X chromosome that carries the allele of the characteristic studied.

If the woman is homozygous (XAXA) for two dominant alleles then all her progeny will inherit the allele and also express the characteristic.

If a man is hemizygote for a dominant X-linked, therefore all his daughters will express the characteristic while none of their sons will do so since they inherit the Y chromosome from the father.

Affected men with normal wives do not have affected men, but affected daughters.

More abundant in females than in 50% males.

Example: Rett syndrome

You might be interested in
NOT BIOLOGY ITS PHYSICAL SCIENCE how are the allotropes of carbon similar and how are they different?
Rashid [163]

Allotropes of carbon includes substances such as graphite, diamond or buckminsterfullerene.



They’re all similar in the thing that they’re all made out of carbon only.


However, their structure is different, such as graphite has a layer structure, diamond has a tetrahedral structure, and buckminsterfullerene has a spherical structure.  



Since they have different structures, they have different physical properties too. For example, diamond is hard because all the carbon atoms in the structure is held together by strong covalent bonds, while graphite are graphene layers that are held by weak intermolecular forces which makes the layers slide over each other easily thus making graphite soft.

7 0
3 years ago
In humans, what is the only homologous chromosome pair that isn't the same?
Katen [24]

Answer;

-23 in males

In humans, 23 in males is the only homologous chromosome pair that isn't the same.

Explanation;

-In humans, each cell normally contains 23 pairs of chromosomes, for a total of 46.

-Twenty-two of these pairs, called autosomes, look the same in both males and females. The 23rd pair, the sex chromosomes, differ between males and females. Females have two copies of the X chromosome, while males have one X and one Y chromosome.

-The 22 autosomes are numbered by size. The other two chromosomes, X and Y, are the sex chromosomes.

6 0
3 years ago
What must happen for a solar eclipse to occur?
ZanzabumX [31]
The best answer to the question stated above is letter  C.<span>The moon's orbit must cross the plane of the ecliptic.</span>

>><span>Solar eclipses happen when the Moon moves between Sun and Earth, blocking the Sun's rays and casting a shadow on Earth.
>></span>Solar eclipses<span> can happen only during a </span>new Moon<span>.
>>E</span><span>arth's orbit is called the ecliptic plane as the Moon's orbit must cross this plane in order for an eclipse (both solar as well as </span>lunar) to occur
3 0
3 years ago
Read 2 more answers
Which prediction is most likely to happen due to solar energetic particles during a solar
alisha [4.7K]
Well I need some points so
4 0
3 years ago
The instructions, or 'code', in our DNA is dependent upon the order of the _____ in the DNA
dsp73

Answer:

C. Bases

Explanation:

Deoxyribonucleic acid, commonly known as DNA, is the a type of nucleic acid that serves as the genetic material in living organisms. DNA holds information or instructions needed for the synthesis of useful products like proteins that is responsible for growth, reproduction, and general survival of organisms. Hence, it is referred to as the "BLUEPRINT OF LIFE".

However, in the structure the of the DNA molecule, it contains certain monomeric building blocks called NUCLEOTIDES. These nucleotide bases are of four types namely: Adenine, Thymine, Guanine and Cytosine. It is upon these order of nucleotide bases that instructions, or 'code', in our DNA is dependent upon.

7 0
3 years ago
Other questions:
  • The addition of acetyl groups makes histones _______ positively charged, and thus _______ their affinity for dna.
    9·1 answer
  • Please help!!!!!!!! WIll give brainliest!!!!! One theme that connects all information in biology is “stability and change.” Desc
    11·2 answers
  • Why is pink visible in carnation plants
    14·1 answer
  • Name and discuss a source of error in performing and evaluating gel electrophoresis
    11·1 answer
  • Differences between mono di and polysaccharides ​
    9·1 answer
  • Use the diagram to answer the question below. Which sequence lists the cell images in chronological order for mitosis
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Explain this statement, cells are the basic units of structures and function in organisms
    8·2 answers
  • Difference between pure tone and speech audiometer
    12·1 answer
  • Which event took place during the Copernican revolution, when most people started to believe in a heliocentric model of the sola
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!