1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
12

A fruit fly that is true breeding for gray body, vestigial wings (b+ b+ vg vg) is mated with one thiat is true-breeding for blac

k bodym normal (b b vg+ vg+). Draw the chromosomes.

Biology
1 answer:
expeople1 [14]3 years ago
6 0

Answer:

Diagram of the chromosome is attached below.

Explanation:

A fruit fly has gray body and vestigial wings is crossed with a fly with black body and normal wings. These chromosomes represent the pair of homologous chromosomes. These genes are linked gene and present on the same chromosome.

The cross shown below shows the parental generation of the fruit fly.

You might be interested in
How do dolphins adapt to their habitat
zubka84 [21]
They have to adapt to the water, the animals in the ocean, the way they hear and see.

5 0
3 years ago
If a dam is removed, the river and estuary ecosystem will recover<br> A True<br> B False
Novay_Z [31]

Answer:

true

Explanation:

4 0
3 years ago
Read 2 more answers
The process of genetic engineering may include either four or five steps. The diagram represents the five-step process. mc010-1.
Lyrx [107]
The answer is "B", recombinant DNA.
7 0
3 years ago
How many distinct trnas are needed to translate every codon in the genetic code?
White raven [17]
In the genetic code, codons made of of three bases specify an amino acid. With three bases, there are 64 possible permutations. With three codons corresponding to STOP codons, this leaves 61 combinations that code for an amino acid. This would require 61 distinct tRNA species were it not for the "wobble base"
3 0
3 years ago
A person who is depression-prone tends to have increased activity in his or her:
Stells [14]
Brain and is going insane 
5 0
3 years ago
Other questions:
  • A 2-week-old infant who presents with poor feeding, fatigue, dyspnea, and a murmur is diagnosed with a patent ductus arteriosus
    6·1 answer
  • According to a famous article by Max Kleiber*, the scaling of the metabolic rate or energy consumption for mammals Pₘₑₜₐᵦ (measu
    14·1 answer
  • Please help asap!
    9·1 answer
  • List 4 types of carbohydrates
    14·1 answer
  • 5.
    9·1 answer
  • How does a virus enter its host cell? PLZ HELP!!
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • 3) which is not an example of dissolving
    7·2 answers
  • How do antigens and antibodies interact? PLEASE HELP NO LINKS PLEASE
    12·1 answer
  • The cell membrane regulates the movement of molecules in and out of the cell. What other functions does the cell membrane perfor
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!