1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IceJOKER [234]
2 years ago
14

What type of diffusion is aided with a transport protein?

Biology
1 answer:
babymother [125]2 years ago
6 0

Facilitated diffusion is the diffusion of solutes through transport proteins in the plasma membrane. Facilitated diffusion is a type of passive transport. Even though facilitated diffusion involves transport proteins, it is still passive transport because the solute is moving down the concentration gradient.

You might be interested in
What is an acid?
Whitepunk [10]
B is correct

Acids are molecular compounds that release hydrogen ions. A binary acid consists of hydrogen and one other element.
7 0
3 years ago
The faster a cheetah can run, the more likely it is to capture its prey. Cheetahs with longer legs are able to run faster than t
stealth61 [152]

Answer:

D

Explanation:

This is the more likely explanation, as there must be a limit to leg length in an animal that has to run very fast and strain their muscles and bones to the limit to do so.

As for the other options, there is no evidence to conclude that the genes that are involved in cheetahs leg length do not undergo mutation because the population exhibits a variety of leg lengths. Neither can we conclude that there are any isolated subgroups in the pupulation. Natural selection does act upon the traits involved in predation, as the question starts by saying that the faster a cheetah can run the more likely it is to capture its prey.

8 0
3 years ago
Why are people called people.
Goryan [66]

Answer:

People are call people because a group of human being in a group is call people; we're all people.

Explanation:

4 0
3 years ago
Read 2 more answers
Choose the correct connective tissue.
PSYCHO15rus [73]

Explanation:

A tendon is a fibrous connective tissue which attaches muscle to bone. Tendons may also attach muscles to structures such as the eyeball. A tendon serves to move the bone or structure. A ligament is a fibrous connective tissue which attaches bone to bone, and usually serves to hold structures together and keep them stable.

6 0
3 years ago
Read 2 more answers
List the terrestrial planets. Recount the goldilocks theory with respect to these planets
mars1129 [50]

The terrestrial planets are Mercury, Venus, Earth, and Mars.

Here's the explanation in regards to the Goldilocks Theory.

The Goldilocks Theory is often used by astrologists to describe the conditions of Earth's positioning in the solar system. The Goldilocks Zone was described by Stephen Hawking as "like Goldilocks, the development of intelligent life requires that planetary temperatures be ‘just right’” The Goldilocks theory argues that a planet must be neither too far away from nor too close to a star and galactic center to support life, while either extreme would result in a planet incapable of supporting life. Terrestrial planets such as Mercury, Venus, Earth, and Mars are more likely  to lie in the Goldilocks zone due to their close proximity to their home star along with other crucial factors that allow for life to exist.

7 0
3 years ago
Other questions:
  • Why is the oceanic crust more dense than the continental crust?
    14·1 answer
  • Propagation of an action potential in a skeletal muscle cell links the signal from a motor neuron to contraction of the muscle c
    7·1 answer
  • which statement correctly explains a difference between the cells of prokaryotes and the cells of eukaryotes
    5·1 answer
  • What two ions make up most of the salt in seawater with percents?
    6·1 answer
  • The goal of all atoms on found on the Periodic Table is to become stable.<br> True<br> False
    10·1 answer
  • Upon examining a crime scene you don't locate any visible prints. To identify latent prints you will have to use a powder. There
    7·2 answers
  • Which of the following results in the release of nuclear energy?
    12·1 answer
  • Why do concentration gradients exist?
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Line B in the given graph represents the reaction with an enzyme added to substrates. How did the enzyme affect the reaction?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!