1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetllana [295]
3 years ago
10

Does Glycolysis joins glucose to other molecules to make pyruvate.

Biology
2 answers:
Ronch [10]3 years ago
6 0
Overall, glycolysis converts one six-carbon molecule of glucose into two three-carbon molecules of pyruvate.
Mandarinka [93]3 years ago
3 0
Glycolysis is the breakdown of glucose by enzymes releasing energy and pyruvic acid. Can i get brainliest please
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
In the process called ________, species act as agents of natural selection on one another. succession mutualism competition symb
Fofino [41]
The process coevolution is a type of relationship between organism wherein they reciprocally affects each others evolution.
3 0
2 years ago
What is an increase in sudoriferous gland activity called?
il63 [147K]
An increase in sudoriferous gland activity is called hyperthyroidism.
It happens when these sudoriferous glands, which are also known as sweat glands, affect the thyroid gland in such a way that it starts producing excessive amounts of thyroid hormone, which leads to this condition. In normal amounts, thyroid hormone regulates metabolism, but if there is too much of it, it can cause problems.
5 0
3 years ago
In humans, eye color and height are controlled by:
Advocard [28]

Answer: It is b multiple alleles

Explanation: Alleles determine your genes.

6 0
2 years ago
________ is a fluid similar to cerebrospinal fluid that fills the space between the bony labyrinth and the membranous labyrinth.
tatiyna

Answer:

<u>Perilymph</u> is a fluid similar to cerebrospinal fluid that fills the space between the bony labyrinth and the membranous labyrinth.

Explanation:

The inner ear consists of the bony labyrinth and the membranous labyrinth, it is filled of endophilia and surrounded by perinfilia (the bony labyrinth surrounds the membranous, between both there is a space occupied by the perilymph). Perilymph is an albuminous fluid that has an ionic composition similar to the extracellular environment, it bathes the tympanic and vestibular ramps, fully occupying the bony cavities of the inner ear, bathing the membranous parts located inside these cavities.

7 0
3 years ago
Other questions:
  • Geraldine suffered a stroke which left her with language impairment. she has good comprehension, but produces speech that contai
    8·1 answer
  • In a well-constructed essay, describe why biodiversity increased with the introduction of sea otters in California over the last
    9·1 answer
  • An energy company wants your help to reduce their use of fossil fuels by utilizing a light source. how can research into chlorop
    13·1 answer
  • A series of programmed changes encoded in dna, through which a fertilized egg divides into many cells that ultimately are transf
    5·1 answer
  • The type of anemia that is seen in severe folate deficiency is characterized by large, immature blood cells. This type of anemia
    8·1 answer
  • Which element is NOT generally found in proteins ? A. carbon B. oxygen C. phosphorus
    5·1 answer
  • Brainliest for whoever answers quickest in the next 5 mins. And correctly
    15·1 answer
  • 14. Show the cross for two heterozygous guinea pigs.
    7·1 answer
  • What is the name of the project that had the goal of sequencing all of the bases that make up human DNA?
    15·1 answer
  • In studies of disease-discordant monozygotic twin pairs, one searches each pair for __________________, focusing on those areas
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!