1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arsen [322]
3 years ago
7

2. What are the characteristics of living things? Do all living things need these

Biology
1 answer:
serg [7]3 years ago
4 0

Answer:

Movement

Respiration

Sensitivity

Growth

Reproduction

Exceetion

Nutrition

Explanation:

no, other organisms like viruses do not show all these characteristics.

You might be interested in
Pizza is an example of a homogeneous mixture.<br><br> true or false?
slava [35]
"Homo" means the same. So no, Pizza is not the same consistently, On one slice you may have two pepperonis and on another 3.
Hope this helps!
5 0
3 years ago
Small, prolific mussels called zebra mussels were first introduced into the Great Lakes by a foreign cargo ship. They became a s
Dvinal [7]

Answer: Yes, because Congress may adopt laws regulating navigable waters.

Explanation:

It should be noted that municipalities using copper-based paint on their intake pipes can successfully be prosecuted for violating the federal law because Congress may adopt laws regulating navigable waters.

Under the Supremacy Clause, when the action of either the state government or the local government conflicts with the federal laws which are deemed valid, then such cities can be prosecuted.

8 0
3 years ago
A bunch of amino acids attach together is called a
Yuliya22 [10]

<span>A polypeptide is a single linear chain of many amino acids, held together by amide bonds. A protein consists of one or more polypeptides (more than about 50 amino acids long). An oligopeptide consists of only a few amino acids (between two and twenty).  </span>

<span />A polypeptide

7 0
3 years ago
Read 2 more answers
Which pH is the most alkaline?<br> a. 5<br> b. 7<br> c. 10
adoni [48]

Answer:

c. 10

Explanation:

The pH scale ranges from 0 to 14.

0 is the most acidic

7 is neutral

14 is the most alkaline

10 is near 14

6 0
3 years ago
Read 2 more answers
Give me an example of a stimulus and response
Semmy [17]
Stimulus - you move your hand over a hot flame
Response - you quickly pull your hand back
4 0
4 years ago
Other questions:
  • ~~9. what are the haploid reproductive structures of fungi called? (1 point)
    11·1 answer
  • A researcher is creating pedigrees for a trait he suspects to be dominant in humans. what are some of the likely features of his
    13·2 answers
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • What abiotic factors in the grasslands affect the zebra
    9·1 answer
  • What is animalus anthropomorphicus and why is it so dangerous?
    11·1 answer
  • Select all the correct answers.
    9·1 answer
  • a. What are the two genotypes of the grandparents? ________ b. What is the genotype of Jane's husband? ________________ c. What
    6·1 answer
  • What formations are made up of molten rock that has cooled
    5·1 answer
  • Why does Mr. Evil think that he will be able to tunnel from Snivley's grandmother's house to the Daily City back at some point i
    7·1 answer
  • In our solar system, why is Earth the planet best suited for life?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!