1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kompoz [17]
3 years ago
6

If high temperatures are most effective at killing microbes, what statement correctly explains why some foods products are treat

ed with temperatures below the boiling point of water?
A.extremely high temperatures would destroy the foods nutritional value

B. extremely high temperatures would significantly lower the food’s shelf life

C. extremely high temperatures promote the growth of some microbes

D. Extremely high temperatures can destroy the foods desirable characteristics
Biology
1 answer:
Semmy [17]3 years ago
5 0

Answer:

A.extremely high temperatures would destroy the foods nutritional value .

Explanation:

Hope it helps.

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which of the following does not occur during mitosis? A centrometers B chromosomes replicate C spindles form
qwelly [4]

A. Centrometers.


is the answer

8 0
3 years ago
Read 2 more answers
The population size of a species in a particular area can be determined by a technique known as mark and recapture. True or Fals
aliina [53]
I believe the answer is True.<span />
8 0
3 years ago
Restriction endonucleases are especially useful if they generate sticky ends. What makes an end sticky?
Mazyrski [523]

The question is incomplete as it does not have the options which are:

A) single-stranded complementary tails

B) blunt ends

C) poly-A sequences

D) 5' cap

E) interference

Answer:

A) single stranded complementary tails

Explanation:

Restriction endonuclease is the enzyme which cuts the DNA sequence in the internal sequence.

The endonuclease enzyme can cut the DNA sequence in a way that it can form the cuts with the single-stranded overhangs called sticky ends and without overhangs called blunt ends.

The sticky ends are produced when the enzyme makes cut at the single strand and then makes the cut at between the same base at the nitrogenous base. This type of asymmetrical cut forms the single-stranded overhangs which can form the complementary base pairs easily.

Thus, Option-A is correct.

5 0
3 years ago
The brain of an alzheimer's victim displays plaques, which are _____, and tangles, which are _____.
pav-90 [236]

Scientists can also glimpse the awful effects of Alzheimer's disease when they look at brain tissue beneath the microscope:

Alzheimer's tissue has numerous fewer nerve cells and synapses than a well brain.

<span> <span>Plaques, unusual clusters of protein particle, which are construct up between nerve cells.</span> </span> <span> <span><span>Dead and dying nerve cells contain tangles,</span> which are produce of twisted strands of a further protein.</span> </span>

<span>Scientists are not absolutely sure what causes cell death and tissue deficiency in the Alzheimer's brain, but plaques and tangles are key suspects.</span>

3 0
4 years ago
Other questions:
  • Which process produces a greater number of offspring? A) chromosome duplication. B) asexual reproduction. C) gamete formation. D
    12·2 answers
  • Explain how hyperinflation might lead to a severe decline in total output.
    10·1 answer
  • 1. Which of the following is an accurate description of mitosis and meiosis? A. Mitosis produces two diploid daughter cells, whi
    13·2 answers
  • Which of the following is true regarding how epithelial tissue and connective tissue relate to each other?
    10·1 answer
  • In the meselson-stahl experiment, cells were grown for one generation in growth medium containing a relatively heavy nitrogen is
    15·1 answer
  • The survival of a living organism occurs whene there is a? If the body organism
    6·1 answer
  • Will mark brainliest
    12·1 answer
  • Which observation could be traced back to the practices of early hunter gatherer societies ? A.The use of rooftops for family ga
    7·1 answer
  • BEST/FIRST ANSWER GETS BRAINLYEST!!!! PLEASE HELP
    12·1 answer
  • What evidence supports the idea that some energy remains untapped in the products of fermentation?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!