1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
3 years ago
15

Which food would be helpful in increasing fiber and regularly clearing the digestive tract?

Biology
1 answer:
Mazyrski [523]3 years ago
8 0
I believe its ginger
You might be interested in
The exchange of oxygen, food, and waste between mother and fetus occurs at.....
umka21 [38]
The exchange of oxygen, food, and waste between mother and fetus occur in the placenta.
6 0
3 years ago
Read 2 more answers
What environmental factors affect kinetic energy and diffusion?
kakasveta [241]
<span>There are several environmental factors that affect the kinetic energy and diffusion. The environmental factors are temperature, molecular size, and pressure, nature of the material and the concentration of the material</span>
3 0
3 years ago
What is the main difference between mature xylem cells and mature ploloem cells?
djverab [1.8K]
Xylem cells<span> die as they </span>mature<span> while </span>phloem cells<span> are alive at maturity.</span>
8 0
4 years ago
2. Fill in the chart on the three types of RNA.
Inessa05 [86]

Answer:

Function:

mRNA: mRNA can be described serves intermediate molecule between the genetic material and the amino acids for the making of protein.

rRNA: It makes up the ribosomes along with the ribosomal proteins. Ribosomes are the sites where the process of translation occurs.

tRNA: The tRNA is involved in the bringing of the nucleotides to the ribososmes for translation.

7 0
3 years ago
What is a hipótesis
antoniya [11.8K]

Answer:

A Hypothesis

Explanation:

4 0
4 years ago
Other questions:
  • You and a friend are in line for a movie when you notice the woman in front of you sneezing and coughing. Both of you have been
    15·1 answer
  • The chemical that neutralizes the acidic chyme so that the lining of the small intestine is not eroded is _____.
    6·1 answer
  • They are passed down through gametes from each parent, which are created by the process known as
    13·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which location has the most earthquakes, hurricanes, and volcanic activity?
    6·1 answer
  • You are a forensic scientist. For today, your supervisor tells you to perform a confirmatory test for semen on Item D. You recov
    12·1 answer
  • Southern Italy is very close to the border of two tectonic plates. Which of these facts is most directly related to the closenes
    8·1 answer
  • can someone please tell me what the heck the classification is for phytoplankton like starting from domain to species
    5·1 answer
  • In active transport, carrier proteins
    5·1 answer
  • Which list of characteristics describes organisms classified as bacteria?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!