What determines how a mineral cleaves? O A. The color of the mineral O B. The size of the mineral O c. The presence of silicates
O D. The strengths of the bonds between atoms
1 answer:
Answer: i believe its D, the strength of the bonds between atoms
Explanation:
(apex)
You might be interested in
agcgggaugagcgcauguggcgcauaacug
DNA synthesis or DNA replication
Since DNA replication retains one parent strand as it forms two new DNA molecules it is called semiconservative method.
Hello There!
I remember taking this test on FLVS. I believe the answer is
A: Eukaryotic cells have multiple membranes.
Hope I helped :D
Heterotroph: an organism deriving its nutritional requirements from complex organic substances.
