1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
1 year ago
7

Which behavior is a learned adaptation? A.a baby learning how to use a fork to eat B. mating C. all behaviors are learned D.slee

ping
Biology
1 answer:
ale4655 [162]1 year ago
4 0
A. A baby learning to how to use a fork
You might be interested in
What is a producer that can be found in the Hawaiian atoll reef?
zavuch27 [327]
I think it’s photosynthesis not 100% sure
6 0
3 years ago
Please help quick!! Asap in test!
fomenos

Answer:

b........................

7 0
3 years ago
Read 2 more answers
Explain how your phenotype can be changed without mutations to your genes.
inysia [295]
An example of this would be eye color. You can put contacts in changing the color but not necessarily changing the genes.
3 0
3 years ago
Which macromolecule would be considered as a quick energy source found in pasta and breads?
Dafna1 [17]

Answer:

Carbohydrate

Explanation:

3 0
3 years ago
All organisms in an ecosystem are interrelated by the abiotic and biotic resources they use in the course of their lives:
jonny [76]

<span>a)      </span>The milkweed is the primary producer in the ecosystem. It manufactures food from the abiotic factors in the soil such as nitrates and water and those in the atmosphere such as carbon-dioxide and sunlight. The milk weed is then fed on by the caterpillar and a primary consumer. The caterpillar is then fed on the mocking bird (secondary consumer)

<span>b)      </span>Increased human population growth and their activities have resulted in the emission of carbon dioxide and other greenhouse gases in the atmosphere. This has increased the global temperature. This increase of global temperature increase ocean temperatures causing coral bleaching.

Another example is depletion of water sources by human activities hence causing drought. Drought reduces the amount of vegetation growth due to scarcity of water in the soil (due to lowering of the water table) for plant growth.  

3 0
3 years ago
Other questions:
  • 20 POINTS NEEED ASAP ON A TEST What are the similarities and differences in the way geologists and biologists approximate the ag
    5·2 answers
  • A 6-year-old girl visits the pediatrician with symptoms of excessive thirst, frequent voiding, weakness, lethargy, and headache.
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which sentence in the passage describes the benefits of sexual reproduction?
    7·2 answers
  • Hormones are signaling substances that bind _____
    12·1 answer
  • Why is water conservation important?
    15·1 answer
  • Idk the answer! I’ll mark brainliest whoever puts in answer within 10 minutes!!
    13·1 answer
  • 4. What performance enhancing drugs are used in other professions?
    5·1 answer
  • How many excretory pores are on each segment of an earthworm?​
    14·2 answers
  • Articulations are classified by their function or structure. Which of the following is an example of functional classification?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!