1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuri [45]
3 years ago
6

What are the headings of a data table

Biology
1 answer:
nevsk [136]3 years ago
3 0
The names of it so like- miles|hours
You might be interested in
I need some help please(;
GarryVolchara [31]

Answer:

C. Photosynthesis OR D

Explanation:

Photosynthesis converts carbon dioxide and water into oxygen and glucose. It fits the image pretty well.

***C makes the most sense to me, but it could be D. I'm not sure.

Forgive me if I'm wrong.

8 0
3 years ago
Is the trait being tracked in the pedigree a dominant trait or a recessive trait?
Viktor [21]

Answer:

The trait being tracked is a recessive trait because less people have it.

7 people don't have it and 5 people do.

4 0
3 years ago
Amanda teaches the art of quilling to 4 students. These students each teach the art of quilling to 4 other students. If this pro
Lelechka [254]
First generation: 4 students.
Second generation : 16 students ( or 4^2 )...
Fifth generation: 4^5 = 1,024
Answer: For 5 generations 1,024 people will know this art.
5 0
4 years ago
Why does DMD affect mostly boys? Describe the type of inheritance pattern that DMD follows.
Aliun [14]

abacadabrabra just needs some points srry

5 0
3 years ago
Which of the following problems is more likely to cause disease during aquaculture farming? (3 points)
Aneli [31]

Answer: b, large density of fish in a small holding area

Explanation: I just finished the assignment and it was correct.

8 0
3 years ago
Other questions:
  • If a forest has many large trees with lots of leaves, what will most likely be found
    15·1 answer
  • Segments of transferred from parent to offspring are called genes.
    14·2 answers
  • Spinal bifida may result in a hernia of the spinal cord and its covering membrane protruding to the outside of the body. this co
    5·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • PLZ HELP ME QUICKLY PLZZZZZ!!!!!!!!!!!<br> The atmosphere controls and distributes heat. True False
    15·2 answers
  • What is the color of ozone?
    5·2 answers
  • Water molecules are attracted to the molecules in the wall of the glass container
    5·1 answer
  • What do pioneer species do
    13·1 answer
  • What is bacterial conjugation?
    9·2 answers
  • State the shortest number of days it takes an Earth observer to see the same phase of the Moon twice.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!