Answer:
I think you mean 'Prophase' and I'm going to give you the definition
Explanation:
Prophase is the first phase of mitosis, the process that separates the duplicated genetic material carried in the nucleus of a parent cell into two identical daughter cells. During prophase, the complex of DNA and proteins contained in the nucleus, known as chromatin, condenses.
Answer
Examine the cladogram of whales and their ancestors presented in this video. Note that this diagram does NOT show modern whales evolving from any specific fossil form, but from the common ancestors of known fossil species and modern animals. Discuss the important difference between this view of evolutionary history, and the old view which often attempted to identify specific fossils as the ancestors of a living form.
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Answer I had in answer just like this and I geussed wish could help u
Explanation:
I believe it's RNA. But double check that please.
