1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rewona [7]
3 years ago
11

If two organisms are able to carry out the same life function, we can expect to find which of the following?

Biology
1 answer:
SCORPION-xisa [38]3 years ago
4 0

Answer: C. Both organisms live in the same habitat.

You might be interested in
A population ecologist determines the number of oak trees per square unit in a forest. What is he trying to infer by doing so?.
morpeh [17]

The answer is letter C. The distribution of oak trees in an area.

Population Ecologist would often measure the number distribution and density of the area. Trees are often measured by plots or by hectares. This is to know how many trees are situated in that area.

4 0
3 years ago
Which type of cells will undergo mitosis.​
rodikova [14]

Answer:

eukaryotic cell...........only

5 0
3 years ago
Read 2 more answers
What are the major types of mountains?
masha68 [24]

Answer:

<em><u>The answer is</u></em>: <u>Folded, fault block, volcanic.</u>

Explanation:

<u>The main types of mountains are</u>: Folded, fault block, volcanic and upwarped.

Folded mountains. These types of mountains tend to change constantly depending on their complexity, however they always conform to the basic type.

Volcanic mountains. It is about the mountains that come to form when a volcano erupts.

Domes. These mountains are created by domed strata, as a granitic intrusion is generated.

Mountains in block. These are large-scale structural failures. These inside are usually folded and tend to have failures.

Plateau mountains. These are created when there is activity in the deepest of the earth's crust. They are formed with the deep channels that the current water produces, where the rivers can cut any table regardless of their depth, thus producing high-rise mountains.

<em><u>The answer is</u></em>: <u>Folded, fault block, volcanic.</u>

8 0
3 years ago
When do a scientific theory change
Pavel [41]
A scientific theory changes when there is more information available about what the theory covers.
6 0
4 years ago
Read 2 more answers
bees and butterflies are dependent on flowers for their food. However the more successful of the two will get the nectar. Which
posledela
I think it’s competition, since they both need to compete to get the nectar.
7 0
3 years ago
Other questions:
  • Why does Ice Float on water? How does this affect life in Earth’s aquatic environments?
    13·2 answers
  • The nurse researcher is conducting research on the effect of homelessness on how often a woman performs self-breast examinations
    10·1 answer
  • What is the purpose of cholesterol?
    8·1 answer
  • What is the difference between Myeloid and Lymphoid hemopoiesis?
    5·1 answer
  • Which of the following describes a phenomenon that occurs when we observe plants that wilt?
    6·2 answers
  • Complete the sentence. A good team member will actively listen, which means they will ______.
    10·2 answers
  • When organic matter in soil decomposes, it creates a layer called _____?
    5·1 answer
  • About 88 percent of geologic time is represented by the time span called the ________ era. paleozoic phanerozoic mesozoic precam
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • During fertilization , the parts of the sex cell that join are the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!