Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
adrenal glands
Explanation:
also known as suprarenal glands
Your body constantly produces new cells. Normal cells follow a typical cycle: They grow, divide and die. Cancer cells, on the other hand, don't follow this cycle. Instead of dying, they multiply and continue to reproduce other abnormal cells.
Answer:
When something goes wrong with the sinoatrial node, you may develop a consistently slow heartbeat (sinus bradycardia) or the normal pacemaker activity may stop entirely (sinus arrest). If sinus arrest occurs, usually another area of the heart takes over pacemaker activity. This area is called an escape pacemaker.
Explanation:
Happy to assist! If you have any questions or comments, plz comment in the boxes below! Have a wonderful day!!!!!!
-Mackie
<span>Adenosine triphosphate, ATP</span>
