1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
satela [25.4K]
3 years ago
8

What did the human genome project produce? a complete map of all potential genes a map disease-linked genes a genetic map of the

23 human chromosomes a list of all the genetic base pairs
Biology
1 answer:
Orlov [11]3 years ago
3 0

Answer:

A genetic map of the 23 human chromosome

Explanation:

You might be interested in
Which of the following statements are true regarding olfaction? Check all that apply. a)Smell is a chemical sense. b)Odorant mol
MrRa [10]

Answer:

A.) Smell is a chemical sense.

B.) Odorant molecules dissolve in mucus before stimulating a receptor

C.) Olfactory receptors have hairs on the apical surface that respond to stimuli

7 0
3 years ago
An ecosystem has experienced a flood
sergejj [24]
Well trees and live animals well be affected 

6 0
3 years ago
A population of tree-climbing lizard live on one bank of a large river. The other bank of the river is a treeless prairie. Durin
algol13

It would be mutation cause

3 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
What are the structural characteristics that give the phosphoanhydride bond its high-energy status?
Bas_tet [7]

Answer:

The answer to the given question out of the four options provided is given by:

Option a. Hydrolysis products are more resonance stabilized.

Explanation:

The answer selection to the above question can be justified as Phosphoanhydride on hydrolysis releases free high energy as the bonds formed by phosphoanhydride are the bonds with high energy.

Therefore, the product of hydrolysis after releasing this energy is more resonance stabilized.

5 0
3 years ago
Other questions:
  • If a cell with 40 chromosomes undergoes mitosis, each of the ____ daughter cells will have____ chromosomes.
    10·1 answer
  • Helppppoop 5th grade work
    13·2 answers
  • What happens to the atp molecule after it has been used to do work?
    15·1 answer
  • Can you tell if this plate boundary is divergent or convergent ? Explain
    8·2 answers
  • Definition for synthesis ​
    8·1 answer
  • B. Analyse a solution in terms of its<br> Solute,solvent, and concentration
    9·1 answer
  • The cell membrane, cytoplasm, and nucleus are collectively called the
    9·2 answers
  • As part of your independent study in field biology, you are sent to a small, inland sea. In one of your samples, you discover a
    10·1 answer
  • What is the definition of biosphere? (1 point)
    6·1 answer
  • Neurons in the hypothalamus regulate the activity of secretory cells in the anterior pituitary gland by:________
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!