1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
3 years ago
7

Where does the Aurora Borealis occur in the layers of the atmosphere?

Biology
1 answer:
almond37 [142]3 years ago
7 0
Auroras normally occur in the Earth's thermosphere.
You might be interested in
Loggerhead sea turtles lay their eggs in nests on the beach. A new hotel is being built on the beach, and there are many big mac
Korvikt [17]
The answer is a they will be removed
3 0
3 years ago
Read 2 more answers
Whole-grain flour contains all parts of the grain with the exception of the bran. husk. germ. endosperm?
irakobra [83]
Answer;
Husk.
Whole-grain flour contains all parts of the grain with the exception of the husk.

Explanation; 
Whole grain foods contains the following parts; Bran, Endosperm and Germ, originally present before processing.
Refined grains on the other hand are mainly  composed of only endosperm portion of the grain. Milling process removes bran and some also removes germ, along with the majority of fiber, vitamins, minerals, antioxidants and phytochemicals. 
8 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Granite is a common type of rock found in Yosemite National Park. Limestone is a common type of rock found in Kentucky.
Elena-2011 [213]

Answer:

You should visit Kentucky.

Explanation:

Limestone is a sedimentary rock formed from the calcareous remains of dead creatures. Limestone is mostly made of shells and other remains of organisms that have collected over time. These are good conditions for fossilization. Granite, however, is an igneous rock formed from solidification of magma in the Earth's crust. High temperatures and extreme conditions make fossilization unlikely.

8 0
3 years ago
The nurse is performing an assessment on a client who presents with a rash. the client states that the rash is on his back and i
Andre45 [30]
I think assess the client's back visually. 
7 0
3 years ago
Other questions:
  • Nicotine from cigarette smoke does not produce congenital malformations but it does
    10·2 answers
  • Which event does the ocean conveyor belt virtual lab predict will occur at the highest temperature setting?
    12·2 answers
  • Which of the following best describes the significance of the sequence individual's DNA?
    5·1 answer
  • Which metamorphic rocks are most likely to have formed at the highest temperatures and pressures?
    15·2 answers
  • I Which structural characteristics is seen in RNA but not in DNA?
    15·1 answer
  • Why should we only produce what nature can process?
    13·1 answer
  • True Or False?<br><br> Does Cytokinesis and mitosis do not overlap.
    15·1 answer
  • 6 At what temperature does liquid
    8·2 answers
  • Who are autotrophs ?​
    14·2 answers
  • Please help me!! what is the probability that a yellow (Y) and wrinkled (r) pea will appear from a cross of RrYy x RrYy?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!