1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirza4 [7]
3 years ago
12

You are an ecologist collecting data about the declining growth rate of the critically endangered Philippine eagle. The eagles'

only known population is estimated to have about 350-650 individuals. Which of the following can you assume is zero?
a. natality
b. mortality
c. emigration
d. immigration
Biology
2 answers:
Usimov [2.4K]3 years ago
8 0

Answer: You can assume a. natality is zero as the population is decreasing.

Hope this helps!  :)

Explanation:

Ulleksa [173]3 years ago
5 0
You can assume D. immigration is 0
You might be interested in
Mention 5 reasons why animal moves<br>​
Blizzard [7]

Answer:

In the search of food for their survival.

To protect themselves from their enemies.

To get a suitable temperature for their reproduction.

To get a perfect habitat to increase their survival rate.

To get more prey and a safe place.

In search of a better climate that suits their body.

5 0
3 years ago
Why do modern humans crave food that is high in fat and sugar
abruzzese [7]
These preferences may have been advantageous in our evolutionary history, when food was less reliably available

-from quizlet
8 0
3 years ago
I will Give Brainliest To Whoever Gets This Right!!!!!!!!!!!!!!!!!
patriot [66]

Answer:

It's too hard

Explanation:

do you go to school. What grade/year are you in?

3 0
3 years ago
Please help i give 48 points !!!which correctly lists the three layers in which water moves easily
Aliun [14]

soil, rock, organic layer

Explanation:

Permeability is the ability of a layer of rock to transmit fluid such as oil or water

The factors that affect the permeability of a rock layer includes the sizes of the rock particles, the ratio of the available voids to the solid mass of the rock, the presence of trapped air and the presence of organic matter

Rocks such as gravels, and  sparingly cemented sands have high permeability

The most impermeable of the options are granite and clay which for granite has large particle mass and contain no voids while clay has very fine particles packed together with little room for water

Therefore, water moves easily between layers  soil, rock, organic layer

7 0
2 years ago
Read 2 more answers
What does it mean to have similar embryos?
Ira Lisetskai [31]

Answer:

Signposts that determine the fate of cells.

Explanation:

Embryos for humans and other animals often look alike at certain developmental stages because they share ancient genes. This expression means that a more advanced organism, like humans, will resemble less advanced species during it's development stages.

5 0
3 years ago
Other questions:
  • In which case will a sound wave travel the fastest ?
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Where are cells that circulate through the immune system produced?
    9·2 answers
  • How do plants obtain, transport, release, and eliminate matter and energy?
    8·1 answer
  • Which part of a lab report would most likely show a line graph of the data collected?
    7·2 answers
  • What is the process green plants use to make their own food?
    10·2 answers
  • Most fatty acids in food and in the body exist as part of a _______ molecule.
    9·1 answer
  • If a segment of DNA is 5'-TAC GAT TAG-3', the RNA that results from the transcription of this segment will be__________.
    13·1 answer
  • Which of the following is an example of a nucleic acid?
    9·1 answer
  • Allosteric inhibition is when a chemical
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!