1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
8

A _____ accelerates a chemical reaction in a cell.

Biology
2 answers:
trasher [3.6K]3 years ago
8 0

Answer:

catalyst

Explanation:

Grace [21]3 years ago
7 0
Catalyst. A catalyst is a substance that increases the rate of a reaction without being consumed the rate of a reaction without being consumed in process, or being chemically altered. There are many enzymes present in cells, proteases, lipases, that speed up metabolism, and catalysts .


 hOpe this has helped you any . >)
You might be interested in
After chromosomes are formed, during which phase of mitosis do the chromosomes attach to the spindle fibers by their centromeres
lorasvet [3.4K]
4.Metaphase
All of the chromosomes are aligned midway between the spindle poles. A spindle is a dynamic network of microtubules that attaches to and moves chromosomes during nuclear division. Microtubules attach each chromatid to one of the spindle poles, and its sister to the opposite pole.
3 0
3 years ago
Read 2 more answers
On a cladogram, what is a node?
lesya [120]
A, a node is where the different section either split or interconnect in a cladogram.
4 0
3 years ago
Are molecules bigger than cells in the human body? and this is for science
oksano4ka [1.4K]

Answer:

no

Explanation:

5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Does either the mother or the father in a have dimples
dsp73
Idk? I can’t see a picture to let me know if they do or not
4 0
3 years ago
Other questions:
  • Estimating Population Size – Review the two approaches to estimating population size and answer the following questions.
    5·1 answer
  • I am a relatively fast-acting chemical messenger that affects mood, hunger, sleep, and arousal. what am i?
    8·1 answer
  • After the process of blank occurs each daughter cell receives an extra copy of parent cells DNA
    10·1 answer
  • Identify the FALSE statement. The primary atmosphere:
    9·1 answer
  • A variation in characteristics within populations of the same species is called
    15·1 answer
  • Fill in the blank below with the vocabulary word that best completes the sentence.
    7·2 answers
  • An organism of the genus Staphylococcus is ________, while an organism of the genus Spirochaeta is ________.
    5·1 answer
  • Differentiate between leucoderma and albinism​
    10·1 answer
  • The plasma membrane is composed of a phospholipid by layer with embedded proteins what is one of the functions of the embedded p
    12·1 answer
  • 1. In humans, the starting cell in this process has 46<br> chromosomes.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!