1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Basile [38]
3 years ago
8

Would the answer be .0115 Km?

Mathematics
2 answers:
uysha [10]3 years ago
7 0
Yes it would be 0.115 km.
RUDIKE [14]3 years ago
5 0
We know, 1 km = 1000 m
so, 1 m = 1/1000 Km

Now, 115 m = 1/1000 * 115 = 0.115 Km

In short, Your Answer would be: 0.115 Km

Hope this helps!
You might be interested in
I need help ASAP.I need help graphing this problem
Viktor [21]

Answer:

The answer to your question is below

Step-by-step explanation:

Each square values two units

I hope it helps you.

8 0
4 years ago
17 points if you know. Help please
vovangra [49]

Answer:

Step-by-step explanation:

Angles 153 and QRP are straight angles, and thus Angle QRP is

180 - 153, or 27 degrees.

The interior angles of the triangle must sum up to 180 degrees:

27 + (3y + 5) + (2y - 7) = 180.

combining like terms, we get:

5y - 25 = 180, or 5y = 155, or y = 31

Then Angle Q is 3(31) + 5, or 93

Angle P is 2(31) - 7, or 55, and

Angle QRP is 27 degrees (found earlier).

6 0
3 years ago
Tammy and Wyatt are sales associates at the same used car dealership. Their supervisor is planning to promote the employee with
lisov135 [29]
I think the answer is D. The other answers are unreasonable. Wyatt would not get the promotion and just because Tammy's lowest value is bigger than Wyatt's doesn't mean that Tammy gets the promotion. The only reasonable answer is D.

7 0
3 years ago
You are playing a game where you win $5 if you draw a card that is 9 or lower. J, Q, K, and A count as 10. How much should you b
GaryK [48]
3.08 hjknhuiniuniuhybybybyyby
5 0
3 years ago
Find the coordinates of the endpoint of the image?
ra1l [238]

Given:

The graph of a line segment.

The line segment AB translated by the following rule:

(x,y)\to (x+4,y-3)

To find:

The coordinates of the end points of the line segment A'B'.

Solution:

From the given figure, it is clear that the end points of the line segment AB are A(-2,-3) and B(4,-1).

We have,

(x,y)\to (x+4,y-3)

Using this rule, we get

A(-2,-3)\to A'(-2+4,-3-3)

A(-2,-3)\to A'(2,-6)

Similarly,

B(4,-1)\to B'(4+4,-1-3)

B(4,-1)\to B'(8,-4)

Therefore, the endpoint of the line segment A'B' are A'(2,-6) and B'(8,-4).

5 0
3 years ago
Other questions:
  • Pls answer this question quickly.
    14·1 answer
  • Please help x=10 evaluate f(x) a:24 b :16 C: no solution d :103
    12·1 answer
  • How many feet per minute faster is 27 speed than 31.8 speed?
    13·1 answer
  • B
    11·1 answer
  • Need help solving for X
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How do you solve this? Need help please
    14·1 answer
  • How to multiply 2^4 tell fast im waiting
    10·2 answers
  • Plz plz plz help i'll give 10pts <br> DON'T ANSWER WITH A LINK :)
    12·1 answer
  • Hii! please help asap. i’ll give brainliest
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!