1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anastassius [24]
3 years ago
12

How many quarters are there in three wholes?

Mathematics
2 answers:
olga55 [171]3 years ago
6 0

1/4 *4 = 1 whole

So...

1/4*12=3 wholes

Answer=12

Korolek [52]3 years ago
3 0
There are 12 quaters in 3 wholes
You might be interested in
Hi so I have this problem that I’m stuck on...math is very hard and I need your help
irakobra [83]
The answer to your problem is 10m minus 20n or 10m-20n for short.
3 0
3 years ago
Read 2 more answers
725 divided by 5<br><br><br><br><br><br> Help
nirvana33 [79]

Answer:

145

Step-by-step explanation:

725 divided by 5 is 145

7 0
3 years ago
Read 2 more answers
2 Cans of Paint (x) 5 10 6 9 Bird H​
Dovator [93]

Answer:

y=10x

Step-by-step explanation:

5 0
3 years ago
The longest straw that can fit inside a 5-inch cylindrical cup, if the straw is placed at an angle in the cup, is 6
Softa [21]

Answer:

yo i do primavara to imma do 3.9

Step-by-step explanation:

oh and also if your grades are bad just do to the dashboard page and highlight you grade percentedge and click inspect if you know and if you see you number pecent on the inspect and right click and click edit as htl and change it to any percent you want then just click out of the inspec option and you will have A S AND B S

8 0
3 years ago
The perimeter of a rectangular field is 292 yards. If the width of the field is 63 yards, what is its length?
Feliz [49]

Answer:

83

Step-by-step explanation:

do the math

5 0
3 years ago
Read 2 more answers
Other questions:
  • 40% of the marbles in the bag are yellow. the rest are orange and green. the ratio of the number of orange to the number of gree
    10·1 answer
  • Please help me its urgent!!
    7·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Solve x=4 (.34x + 1.4)
    8·1 answer
  • What is -9+(-2/3)? I ready quiz level G.
    10·2 answers
  • Help help help PLS TY
    7·1 answer
  • Hey can you help me fast!!!
    13·1 answer
  • Hey everyone I need help on the questions please!:)​
    7·1 answer
  • Please help me out! determine the domain on this graph
    15·1 answer
  • 13.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!