I would say A or C I’m not sure but if I had to choose A or C my best guess would be A
I hope this helps :)
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The beak size will either increase or decrease, depending on the past evolution.
Explanation:
Answer:
Interrupt the long winter nights with a brief period of light.
Explanation:
Long day plants, also called short night plants, flower when the dark period is equal or less than the critical period specific for the species. These plants normally flower in summers when nights are short and days are longer. Winters have a long dark period and do not support flowering in shirt night plants.
A continuous dark period is critical for flowering. A short night plant can flower in winters (having longer dark periods) if the dark period is interrupted by exposing the plant with a flash of light. To make short night plants, such as iris to flower in winters, the plant should be given short period of light after completion of critical dark period.
Answer:
Y
Explanation:
the cytoplasm is the gel like substance that holds all organelles
