1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
5

What else is a seed plant have other than vascular tissues?

Biology
2 answers:
mixer [17]3 years ago
6 0
All seed plants share two things vascular tissues and the ability to reproduce. The types of vascular tissue they have are the phloem and the xylem.
kupik [55]3 years ago
3 0

Answer:

Vascular seedless plants include the club mosses, ferns, whisk ferns, and horsetails.

Explanation:

You might be interested in
Radioactive isotopes are use to determinate the [blank) age of rocks
Otrada [13]
Do you have snap because I want new friends
5 0
4 years ago
Which of the following are binary ionic compounds?
earnstyle [38]

Answer by YourHope:


Hi! :)


Which of the following are binary ionic compounds?


C) Copper (II) sulfide


D) Dinitrogen tetroxide!


Have a BEAUTIFUL day~

7 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Define 4 types of teeth(incisors,canines, premolars and molars)
vredina [299]
  • Incisors: Incisors are your two front teeth and the teeth on either side of them on the top and bottom of the mouth. Incisors are designed like tiny chisels with flat, moderately sharp ends. These teeth are formed to cut and chop food.

  • Canines: The pointy teeth beside your incisors are your canine teeth. You have a total of four canine teeth—two on the top and two on the bottom. These teeth are also designed to be sharp for tearing food.

  • Premolars (bicuspids): Premolars or bicuspid teeth are located just beyond the canine teeth toward the back of the mouth. You have eight in total—four on the top and four on the bottom.Premolars are bigger, stronger, and have ridges designed for crushing and grinding food.

  • Molars: In the very back of your mouth are the molars. You have eight molars—four on top and four on the bottom. Molars are your strongest set of teeth, formed with more width and ridges than the premolars. The molars are also designed for chewing and grinding, as well as thorough mashing of your food prior to swallowing. The molars generally do not surface until the ages of 6 to 12.
7 0
3 years ago
Practice It!
kumpel [21]

Explanation:

The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not. The nucleus is where eukaryotes store their genetic information. ... The nucleus is only one of many membrane-bound organelles in eukaryotes.

7 0
3 years ago
Other questions:
  • 1. What is the physical evidence: an element, a compound, or a mixture?
    15·2 answers
  • What is not a property of water A. polar molecule
    14·1 answer
  • Humus is a concentration of decaying, organic matter in the b horizons of lateritic soils.
    8·2 answers
  • How are viruses spread from cell to cell?
    11·1 answer
  • One of the grand challenges in biology is understanding how the first cells formed on Earth. Since all cells are bound by a cell
    14·1 answer
  • The following steps comprise the DNA typing process:(1) electrophoresis, (2) Southern blotting, (3) hybridization with a radioac
    12·1 answer
  • Explain the conditions under which the body would concentrate or dilute urine.
    14·1 answer
  • What’s one thing that makes monkeys special
    8·2 answers
  • 15 PTS PLEASE help I have a deadline in 2 hours this is the only one I need help on PLEASE!!!!!!!
    14·1 answer
  • I AM SO CONFUSED PLEASE HELP THIS IS ON MY STUDY GUIDE FOR FINALS!!!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!