1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slega [8]
3 years ago
11

What do the parietal cell produce? What type of environment is created?

Biology
1 answer:
Kobotan [32]3 years ago
5 0

Parietal cells produce gastric acid (hydrochloric acid) in response to histamine (via H2 receptors), acetylcholine (M3 receptors) and gastrin (gastrin receptors). Parietal cells contain an extensive secretory network (called canaliculi) from which the HCl is secreted by active transport into the stomach.

You might be interested in
How had the study of mitosis affected scientists knowledge of cancer
sweet-ann [11.9K]

it led to a study of how to induce cancer cells to divide more rapidly


4 0
3 years ago
How is the level of oxytocin controlled by a positive-feedback mechanism?
Hoochie [10]
I believe the answer is b 
<span />
6 0
3 years ago
Suppose a newborn baby was accidentally mixed up in the hospital. In an effort to determine the parents of the baby, the blood t
Sladkaya [172]

Answer:a. Draw Punnett squares for each couple (you may need to do more than 1 square/ couple)

Baby 2 MUST belong to the Browns because Mr. Brown is the only parent with an A allele to

contribute… then the rest works out as follows:

b. To which parents does baby #1 belong? Why? Hint you may want to refer to your Punnett

squares.

Baby 1 must belong to the Smiths, because they are the only ones with the possibility of EACH

having a recessive allele to pass down to the baby, Mr. Brown has type AB blood and therefore

only has the dominant A and dominant B alleles – no recessive allele possible.

Explanation:

6 0
3 years ago
What is the difference between a semi-permeable membrane (parchment paper, cellophane paper, etc.) and a differentially permeabl
WARRIOR [948]
Semi permeable membrane will allow something to pass  through them and something not and it will allow on the basis of size particles
while differentialy permeable will include other factors also other than size and will depend on the need of the cell
this is the main difference between them
hope it helps<span />
7 0
3 years ago
What characteristics of muscles help you determine the direction of the movement?
Flura [38]
The relationship between the bone and muscle
4 0
3 years ago
Read 2 more answers
Other questions:
  • How is gametes defined as a scientic form. Is it in which it is for example, dominant trait Aa and recessive trait aa are bred t
    15·1 answer
  • The external oblique is named based on which aspect of the muscles?
    5·1 answer
  • Select the correct statement regarding epithelia.A) Simple epithelia form impermeable barriers.B) Stratified epithelia are prese
    12·1 answer
  • Similarities between pisces and amphibia<br>​
    7·1 answer
  • Hydrogen peroxide is a harmful by-product of normal metabolic activity. In order to prevent damage, hydrogen peroxide must be br
    14·1 answer
  • La funcion del sistema dijestivo es dijerir los alimentos y asimilar los nutrientes
    14·1 answer
  • Which part of a lake is most likely to have no photosynthesis?
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What distance would be covered in 10
    14·1 answer
  • Describe an experiment to show oxygen is given up during photosynthesis​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!