I was looking for an answer and I found this. I hope this helps in some way.
When it comes into contact with a host cell, a virus can insert its genetic material into its host, literally taking over the host's functions.
Answer:
In humans, there is a readiness to perceive ourselves on priority and favorably. This is one of the reasons that helps in increasing the remembering memories of events that are favorable to the individual which results in benefits, it is known as self-serving bias.
Self-esteem is something that helps in knowing the self-worth and the importance of happiness of one's own. Being aware of environmental control result in achieving better in life and experienced less stress. The potential use of the capabilities of individuals results in increasing awareness about what is the purpose of the life of an individual.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:A particle has zero velocity initially (i.e., at time
t=0
t=0
) and its acceleration at
t
t
seconds is
a(t)=72t−4
t
3
a(t)=72t−4t3
meters-per-second per second. During the time interval
[5,8]
[5,8]
seconds find the average acceleration and the average speed of the particle. I got the average acceleration by taking the integral and then plugging that into
f(8)−f(5)/8−5
f(8)−f(5)/8−5
but I have tried working through the average speed and I can't find the answer for that one.
Explanation:
