Answer:
The potential risks associated with plant-based pharmaceuticals include: pollen transfer to related species, contamination of non-transgenic crops intended for the consumption by humans, allergic reactions to the drugs produced from the genetically engineered plant, and persistence of genetically engineered material to persist in the environment and accumulate in non-target organisms. Risk assessment of plant-made pharmaceuticals should be reviewed on a case-by-case basis because the plants used to produce proteins each have different risks associated with them.
Answer:
Please find the explanation below
Explanation:
Sodium (Na) and Chlorine (Cl) are two electrolytes that play important role in the absorption of water and nutrients in the small intestine. However, as mentioned in the question, the release of sodium and chlorine would lead to a loss of water in the intestines. This is because of the OSMOTIC phenomenon.
Osmosis is the movement of water molecules from a region of high concentration of water/low concentration of solute to a region of low concentration of water/high concentration of solute via a semipermeable membrane. In this case, the Na+ and Cl- ions serve as the solutes, which when released out of the intestine causes the solution in the intestines to be HYPOTONIC compared to the intestinal environment. This causes an OSMOTIC GRADIENT.
This osmotic gradient i.e. difference in concentration provokes osmotic flow of water from the intestines, which has a low solute/high water concentration, to the outside of the intestines, which has a high solute/low water concentration. Hence, water is lost from the intestine because the solute concentration becomes low when sodium and chlorine ions are released.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:by rotation that is powered by the motive force
Explanation:
