Answer: Nucleotides are the monomers used for DNA synthesis. The mix also contains a template, DNA taq polymerase, buffer, reverse and foward primer and magnesium ions.
Explanation:
A PCR master mix is a premixed solution that has all of the components for a Polymerase chain reaction (PCR). This reaction is a laboratory technique that amplifies small fragments of DNA into millions of copies.
The master mix used for that contains dNTPs (nucleotides). In the DNA there are four types of nucleotides that are differentiated by the nitrogen base they have: adenine (A), guanine (G), cytosine (C) and thymine (T).
<u>Since nucleotides are the monomers that make DNA, they are found in the mix because they are the material for DNA synthesis.</u>
The reaction mixture also requires;
- DNA template, the sequence of DNA to be amplified
- DNA taq polymerase, a heat resistant enzyme that assembles nucleotides into a new DNA
- Salt buffer, for an optimum ionic environment and pH
- Oligonucleotide primers (reverse and foward), pieces of DNA complementary to the template. Each hybridizes with one of the DNA chains.
- Magnesium ions, a catalyst required by DNA polymerase to work
<span>In vitro fertilization
Not much to say, the question pretty much defines the technique. The first successful birth via IVF happened with the birth of Louise Brown in 1978. There are some issues with IVF that can cause complications. Among them are multiple births (twins or triplets) due to multiple blastocysts successfully implanting in the woman's uterus.</span>
Answer:
clastic sedimentary rock are made up of pieces of pre-existing rocks. pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. if the sediment is very deeply, it becomes compacted and cemented, forming sedimentary rock.
Explanation:
Hope this helped Mark BRAINLEST!!!!
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
disagree, an atom has two main parts. the nucleus & electron cloud. Atoms have three subatomic particles: protons, neutrons, and electrons.
Most atoms have three different subatomic particles inside them.
Explanation:
