1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
1 year ago
5

Mitosis can occur in both haploid and diploid cells, but meiosis cannot occur in haploid cells. Why not?.

Biology
1 answer:
allochka39001 [22]1 year ago
4 0

Mitosis can occur in both haploid and diploid cells because it is equational division where the number of chromosomes remain the same after division. But meiosis cannot happen in haploid cells because it is reductional division and haploid cells do not have any extra copy of chromosomes to be halved.

Mitosis is the cell division where the number of chromosomes do not change after cell division. It usually happens in the somatic cells of the body. Cancer cells also undergo mitosis

Meiosis is the cell division where the number of chromosomes are halved after cell division. The process of meiosis occurs in two phases: meiosis I and meiosis II. The germ cells of the body undergo meiosis.

To know more about mitosis, here

brainly.com/question/26678449

#SPJ4

You might be interested in
What are some diseases that can be passed down as genetic traits? list 5 or more/
Oxana [17]
The diseases which can be passes down as genetic traits are known as "Inheritable disease" some examples are:

1) Haemophilia
2) Phenylketonuria
3) Down's Syndrome
4) Turner's Syndrome
5) Klinefelter's Syndrome

Hope this helps!
6 0
3 years ago
Read 2 more answers
During science class, a group of students went on a field trip to a nearby pond where they collected samples of pond water and p
Alex Ar [27]

Answer:

the organisms internal structures could not be viewed as a scanning electron microscope only provides images of the surface!

Explanation:

3 0
3 years ago
Read 2 more answers
What would happen if cytokinesis did not occur?
12345 [234]

Answer:

Cytokinesis takes place in both meiosis and mitosis and performs the separation of he cell in half and form one nucleus into each daughter cell.

If cytokinesis did not happen, it will from multinucleated cells which means that their will be multiple nuclei in single cell and cell will not get separate in half, and no new daughter cells will form.

4 0
3 years ago
Salts and sugars work to preserve foods by creating a
Ne4ueva [31]

Answer: Hypertonic Environment

Explanation:

The salt solution and sugar solution is used for the process of food preservation as the bacteria and microorganism are not able to grow in such conditions that is being created by the solution.

The amount of the solute is more and the solution is less concentrated. The bacteria cell has less solutes and more solvent.

As per osmosis the water from the salt or sugar solution moves out from bacterial cell shrinks and dies.

This is how the bacterial cell dies and the food is prevented from spoilage.

7 0
4 years ago
Yearly rainfall-12–30 inches; mild summers, cold winters - _________________
Fudgin [204]

Yearly rainfall-12–30 inches; mild summers, cold winters are considered as weather conditions.

<u>Explanation:</u>

To understand the basic difference between the weather condition and climate let’s look into the basic difference. Weather condition is the condition that is been experienced whereas the climate is a condition that is expected to be happening for a long period of time.

Here mild summer and cold winners are the weather condition of that place.  Climate will be the average weather of that particular region. While weather is the condition observed during that particular period climate is the condition observed for years together.

8 0
3 years ago
Other questions:
  • The direction of bilateral transfer between two limbs is typically:
    14·2 answers
  • A science student makes the following statement. A raccoon may live longer when it eats only vegetables. What is the student doi
    7·1 answer
  • Landforms is a physical feature on earth's surface true or false
    11·2 answers
  • What are the three types of symbiosis?
    12·1 answer
  • Which of he following would be considered a qualitative observation
    5·1 answer
  • A _________ happens when some benefits are lost to gain<br> other benefits
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The allele for a recessive trait is usually represented by a capital letter<br><br> True or false
    8·2 answers
  • Which group created a list that would be MOST useful for creating a dichotomous key for this purpose?
    13·1 answer
  • Who is in the same trophic level as the frog? Select all that apply.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!