1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marta [7]
3 years ago
13

_____ describes the life cycle of a star

Biology
2 answers:
LenKa [72]3 years ago
6 0
Stars are formed in clouds of dust and gas (nebulae.) Nuclear reactions at the center (core) of stars gives enough energy to make them shine brightly for many, many years. The exact l<span>ifetime of a star depends on its size.</span>
IgorC [24]3 years ago
4 0

Answer:

Stellar Evolution

Explanation:

You might be interested in
Please help me and answer number 6. Thank you
maksim [4K]
Is there a picture there
6 0
3 years ago
1. How is the nervous system similar to other body systems? How is it different?
Degger [83]

Answer:

it is similar because it involves multiple body parts.

it is different because it doesn't involve breaking down anything or providing things through the blood.

hope i helped...............mark me brainliest?

4 0
3 years ago
The point below ground from which an earthquake's energy is released is called the focus. An earthquake's epicenter is located
Crazy boy [7]
<span>The correct option is C. On Earth's surface directly above the earthquake's focus.
</span>
<span>The hypocenter, or focus is the point where the earthquake really starts. It's located under the surface in the tectonic plate boundary.  </span><span> <span> <span> </span> </span> </span>
The epicenter is the point on the surface of the earth that's directly above the hypocenter.
3 0
3 years ago
Read 2 more answers
Which physical property is the rate at which
Damm [24]
I is answer. Don't open link. It is most likeky unsafe.
6 0
3 years ago
True or False: Homologous structures indicate a shared ancestry but<br> vestigial structures do not
Misha Larkins [42]

Answer:

false false false false false false

6 0
3 years ago
Other questions:
  • Describe the path the blood takes as it flows through the nephron.
    8·1 answer
  • The American Institute for Cancer Research promotes "The New American Plate," which includes plant-based foods covering ________
    10·1 answer
  • Phosphatidic acid is a precursor for the lipid class(es):
    10·1 answer
  • can anyone Expain why it is important for Non scientists to understand how scientists use the terms Hypothesis, a guess and a th
    11·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What determines the type of igneous rock that forms from magma? a. The heat and pressure the magma is exposed to b. Whether the
    15·1 answer
  • ¿que son los lipidos?
    12·2 answers
  • What are the limitations of cell theory​
    5·1 answer
  • n this experiment, you need to examine the idea of thermal energy transfer. Using a controlled experiment, what might a good que
    9·1 answer
  • This is for bio , translation and transcription genetics labelling help me pls
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!