1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
3 years ago
9

I need help with a b c d and e

Biology
1 answer:
ivanzaharov [21]3 years ago
6 0
I can only see a, b, and c, but I know that it’s 4, 3, and 2.

Hope this helps!!!
You might be interested in
Mitosis a single cell divides to produce two daughter cells what must happen in the original sound of the daughter cells has a c
Darya [45]

Answer:

Explanation:

In mitosis, when a single cell divide into two daughter cell and each daughter cells have a copy of chromosomes, there must first be the copying of the chromosomes from the parent cell and after that the chromosomes are separated or there is separation of chromosomes into each of the daughter cells.

4 0
3 years ago
In a fruit fly experiment, grey body, normal winged (homozygous dominant) fruit flies were mated with black body, short winged (
bogdanovich [222]

Answer:

In a fruit fly experiment, grey body, normal winged (homozygous dominant) fruit flies were mated with black body, short winged (homozygous recessive) fruit flies. The F1 dihybrid females were then used in a test cross. If the genes are always linked and no crossing over occurs, what would be the predicted ratio in the F2 generation?

GG x bb = Gb, Gb, Gb and Gb  F1 generation

grey body heterozygous offspring 4:0

Gb x Gb= GG, Gb, Gb, and bb F2 generation

3:1 three grey body fly and one black body fly

Explanation:

6 0
3 years ago
Provide evidence to reject this statement, "Human phenotypes are usually a clear cut either situation"
tensa zangetsu [6.8K]
Wavy hair is a very easy example that this is false.  It's a merge between straight and curly hair.  Our traits tend to mix and blend together, it's not so simple.  Everybody isn't just tall or short, one or the other.  Everybody is a different height because it's a mid between your parents. 
8 0
3 years ago
Read 2 more answers
What steps are involved in creating a hydroelectric power plant
olga_2 [115]
In order to create a hydroelectric power plant, you need water, hence the prefix hydro-. Most times, people use dams to block the water, which in a way stores it. When you need to produce electricity, you release some of the water which flows through a turbine making it spin, which then activates a generator to produce electricity.
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Mistletoe is a plants that absorbs nutrients from living oak trees. this causes damage to the tree. which of these relationships
    15·1 answer
  • When the sun, moon, and earth are lined up in a right angle, the high tides will be _____ than normal, and the low tides will be
    13·1 answer
  • Which is the best definition of literal language? A. words used in ways that make their regular or common meanings clear B. word
    14·1 answer
  • The offspring of a particular cross are 100 percent heterozygous for tallness. What were the most likely genotypes of the parent
    14·1 answer
  • Compared to plants from other environments, the cells of many desert plants contain high concentrations of solutes. This helps t
    9·2 answers
  • What is the effect on the O2 affinity of hemoglobin? An increase in CO from 1.0 parts per million(ppm) in a normal indoor atmosp
    11·1 answer
  • 2. The phosphorus cycle is not<br> O atmospheric<br> O slow<br> O necessary
    11·1 answer
  • Someone pleaseee help me with this !!
    15·1 answer
  • Porque en uruguay existen animales en peligro de extincion
    8·1 answer
  • Why do sex-linked traits follow different patterns of inheritance than other traits ?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!