Cold air creates high pressure low pressure is created by hot/warm air La Nina creates cooler temperature then el nino
Good durnfnnfnfjfjfkkfkfkfkfkfkkfkf
Mantle convection causes tectonic plates to move around the Earth's surface.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
the answer is Ocell because a cell is the building block of all things