1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AysviL [449]
4 years ago
11

In the western U.S., ranchers aggressively killed wolves because they posed a threat to their cattle. As the wolf population dec

lined, the deer population began increasing. As a result, the surrounding forest ecosystems experienced increasing damage. The large number of deer ravaged vegetation and destroyed young trees. The entire ecosystem became degraded until wolves became protected when they were determined to be an endangered species. Based on this information, what can you infer about the role of the wolves in this ecosystem?
Biology
1 answer:
Dafna1 [17]4 years ago
6 0

Answer:

predators to the deer

Explanation:

wolves are predators to the deer because the population of deer increased when the wolf population went down.

You might be interested in
Cold air creates _____ pressure
NISA [10]
Cold air creates high pressure low pressure is created by hot/warm air La Nina creates cooler temperature then el nino
5 0
3 years ago
Beginning from the center of the inside of the Earth, list the layers of the Earth
lana66690 [7]
Good durnfnnfnfjfjfkkfkfkfkfkfkkfkf
4 0
3 years ago
Please use kid friendly words lol
prohojiy [21]
Mantle convection causes tectonic plates to move around the Earth's surface.
3 0
3 years ago
Read 2 more answers
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
4 years ago
What is the basic unit of structure and function of all living organisms?
Aleks [24]

the answer is Ocell because a cell is the building block of all things

5 0
2 years ago
Read 2 more answers
Other questions:
  • Mistletoe (phoradendron spp.) infest many taxa of plants, often causing the branches of the host species to become swollen and d
    5·2 answers
  • Using the data, choose one of the 3 possible problems below. Justify your choice by writing a hypothesis to explain how it has s
    8·1 answer
  • What are the three stages of the general adaptation syndrome?
    7·2 answers
  • Kenny has been diagnosed with parkinson disease and has been prescribed medication to manage some of his symptoms. the medicatio
    7·1 answer
  • Biology: which group contains only molecules that are each assembled from smaller organic compounds?
    11·1 answer
  • 6. The disposal of nitrogen-containing wastes, as through urination, is called ____
    14·1 answer
  • What is the term for a trait that is on an x or Y chromosome
    15·1 answer
  • Which of the following organisms are prokaryotes?<br> 1. plants<br> 2. animals<br> 3. bacteria
    14·2 answers
  • Functions of chlamydomonas​
    12·1 answer
  • Scientists think that dolphins and whales may have evolved from a common ancestor. What evidence supports this hypothesis
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!