1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SCORPION-xisa [38]
2 years ago
15

Tropic of

Biology
1 answer:
Semmy [17]2 years ago
4 0
I just woke him crying and he said I can’t he just got out here and I don’t know why I was just talking abt it and he was just trying so hard to sleep in his
You might be interested in
Which statement is true regarding studies of the empty nest syndrome?
algol13
<span><span>If these are the answers you were able to choose from:

A)Parents who live vicariously through their children are less likely to experience empty nest feelings.
</span><span>B)For most parents, marital satisfaction decreases during the years after child rearing.
</span><span>C)Parents who are heavily invested in their children may suffer from a decline in marital satisfaction after children have left home.
</span><span>D)<span>Marital partners have less time for each other with their children gone.

Then the correct answer would be C - parents who are heavily invested in their children may suffer from a decline in marital satisfaction after children have left home. This also makes sense; they've been parents and not husband and wife. For that reason, following the child's departure, they're not sure what to do with themselves.</span></span></span>
7 0
3 years ago
To what does phylogeny refer?
Naddik [55]
I think the correct answer is B
3 0
3 years ago
Contact forces result from the physical push or pull of an object<br><br> true or false
olga_2 [115]
True - The weight of an object is equal to the force of gravity acting upon the object. .... A contact force results from the physical contact between two objects.
6 0
3 years ago
PLS HELP ME THANKS :) write a short paragraph evaluating the different methods of seed dispersal.
Schach [20]

Explanation:

There are five main modes of seed dispersal: gravity, wind, ballistic, water, and by animals. Some plants are serotinous and only disperse their seeds in response to an environmental stimulus. Because plants cannot walk around and take their seeds to other places, they have developed other methods to disperse (move) their seeds. Dandelion seeds float away in the wind

8 0
3 years ago
Natural selection is based on Darwin’s observation that individuals most likely to survive and reproduce are those _____.
mariarad [96]

Answer:

Explanation:

Natural selection is based on Darwin’s observation that individuals most likely to survive and reproduce are those with traits best suited to their current environment.

8 0
3 years ago
Other questions:
  • In a cross of chestnut X cremello, what proportions would you expect in the offspring?
    8·1 answer
  • What is an organism that breaks down and gains nutrients from dead organisms?
    5·2 answers
  • The organelles responsible for protein synthesis are known as __________ and the organelles that assist with the breakdown of pr
    11·1 answer
  • Which of the following is the correct sequence of blood flow in birds and mammals? A. vena cava → right atrium → right ventricle
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Natural selection merged with the work of __________ in the 20th century to open up our understanding of evolutionary theory. a.
    6·1 answer
  • A plant and an animal are both living things. According to the Cell Theory, what can you conclude about these two
    14·1 answer
  • HELPPPP!!! <br> G:Green <br> B:Blue <br> -what percent of the offspring will have green skin???-
    6·1 answer
  • The _____________ receives blood from the atrium and pumps it out of the heart.
    15·1 answer
  • Question 3(Multiple Choice Worth 4 points)
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!