1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ehidna [41]
3 years ago
5

Please answer the question on the picture

Biology
1 answer:
alexgriva [62]3 years ago
4 0

Answer:

all of these

Explanation:

A non-contact force is a force which acts on an object without coming physically in contact with it. The most familiar example of a non-contact force is gravity, which confers weight. In contrast a contact force is a force applied to a body by another body that is in contact with it.

You might be interested in
Which of the following is not a part of environmental science?
zalisa [80]
The answer is letter D.) the components of a cell

Environmental science is an interdisciplinary field that studies the interactions of the environment. The component of a cell can be studied through the lens of biology and may not require addition disciplines.

<span>Thank you for posting your question. I hope you found what you were after. Please feel free to ask me more</span>


8 0
2 years ago
Read 2 more answers
How is water formed during the electron transport chain
olga55 [171]

Answer:

The electron transport chain is the third and final step of cellular respiration. At the end of the electron transport chain, the hydrogen from the coenzymes meets the oxygen which the cell has consumed and reacts with it to form water. Therefore, water is created as a byproduct of the metabolism reaction.

5 0
2 years ago
Hat is the horizontal line present across the front teeth of this skeleton and what does it represent?
cestrela7 [59]
<span>The horizontal line present across the front teeth are called perikymata. These are incremental growth lines that appear on the surface of tooth enamel as a series of linear grooves. These lines can be used to assess how long the crown of the teeth formed. </span>
3 0
2 years ago
Pericarditis, an infection with an accumulation of fluid in the pericardial sac, can lead to cardiac ________, as the fluid comp
torisob [31]

Answer:

Pericarditis,an infection with an accumulation of fluid in the pericardial sac,can lead to cardiac attack ,as the fluid compress the heart and stops from beating.

Explanation:

Pericarditis is mainly caused by viral infection in the respiratory tract.Pericarditis is an autoimmune disorder as they release antibody which attack body's own tissue and cells.

Pericarditis mainly affect people with age between 20-50

Pericarditis means inflammation in the pericardium region which is a sac like like structure and surrounds the heart.

The symptoms include Chest pain,Cardiac attack  and some times cause death.

Pericarditis may be acute as it happens suddenly and does't lasts for longer time.

6 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
2 years ago
Other questions:
  • At each replication fork, one new strand of dna is made as one continuous piece. what is this strand of dna called?
    8·2 answers
  • Nitrogen is required for growth it is considered an essintisl
    14·1 answer
  • Movement of the chromosomes during anaphase would be most affected by a drug that prevents mitosis and cell division. What is th
    10·1 answer
  • Interviewer-induced bias described in a sentence?
    14·2 answers
  • Which of the following environmental factors would positively influence the survival and reproduction of only light peppered mot
    12·1 answer
  • Pls help me with this and pls stop missing around with this else l report
    13·2 answers
  • How does your nose filter the incoming air?
    14·1 answer
  • Which metal is not magnetic, it floats, and has a reaction with NaOH?
    8·1 answer
  • The cells in the gastric mucosa near the openings of the gastric pits largely specialize in secreting __________.
    12·1 answer
  • a disease agent can affect more than one organ of the body, and more than one disease agent can affect the same organ of the bod
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!