1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
15

Which step of mitosis does the following sentence describe?. . The chromosomes are aligned at the metaphase plate (a plane that

is equally distant from the two spindle poles).. . . A.. . interphase . . . . . B.. prophase . . . . . C.. metaphase . . . . . D.. anaphase . . . . . E.. telophase.
Biology
2 answers:
creativ13 [48]3 years ago
3 0
Its C metaphase
hope that helps
butalik [34]3 years ago
3 0

The phase that describes the alignment of the chromosomes at the metaphase plate which is a plane that is equally distant from <span>the two spindle poles is metaphase. It is the third phase of mitosis which also involves the replication and division of nucleic materials into two. </span>
You might be interested in
Awarding BRAINLIEST answer!! Please help asap!!
S_A_V [24]
One consequence of the overpopulation of deer would be a reduced diversity. Deer tend to eat only some types of plants, so those plants are removed, and other types of plants stay. Hope this helped! Brainliest is always appreciated.
6 0
3 years ago
Read 2 more answers
What is vena cava<br>hello didi and twinkle. ​<br>yeha aavo
ludmilkaskok [199]

Answer:

(VEE-nuh KAY-vuh) A large vein that carries blood to the heart from other areas of the body. The vena cava has two parts: the superior vena cava and the inferior vena cava. The superior vena cava carries blood from the head, neck, arms, and chest.

8 0
3 years ago
Read 2 more answers
Caffeine prolongs and intensifies the effects of epinephrine. Which of the following potential mechanisms of action of caffeine
kherson [118]

Answer:

a. inhibits cAMP phosphodiesterase, the enzyme that converts cAMP to AMP.

Explanation:

The phosphodiesterases are a group of enzymes that are capable of breaking phosphodiester bonds such as those between nucleotides in nucleic acids. The Cyclic adenosine monophosphate (cAMP) is a second messenger involved in intracellular signaling pathways. This molecule (cAMP) is hydrolyzed by the cAMP-dependent phosphodiesterase, which catalyzes the enzymatic breakdown of phosphodiester bonds (i.e., hydrolyzing cAMP to 5-AMP). The cAMP levels are modulated by the balance between its generation and the degradation via cyclic nucleotide phosphodiesterase.

4 0
3 years ago
What contributed to the specification in Darwin's Finch theory
Keith_Richards [23]

Answer:

On his visit to the Galapagos Islands, Charles Darwin discovered several species of finches that varied from island to island, which helped him to develop his theory of natural selection.

Darwin's finches are a classical example of an adaptive radiation. Their common ancestor arrived on the Galapagos about two million years ago. During the time that has passed the Darwin's finches have evolved into 15 recognized species differing in body size, beak shape, song and feeding behaviour.

4 0
3 years ago
What is the kingdom of fungi
patriot [66]
The kingdom of fungi is made up of variety of organisms, such as mushrooms, yeast, molds, etc. The organisms in this kingdom live by decomposing and absorbing the organic molecules on which they grow.
 The major characteristics of the organisms in the fungi kingdom is that they possess hyphae, which they use for absorption of nutrients. 
The organisms in the fungi kingdom are multi cellular eukaryortic and are incapable of producing their own food, that is, they are heterotrophs.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Hunters have greatly reduced the duck population visiting and living around this wetland. We would expect to see an increase in
    6·2 answers
  • Describe the roles of light, carbon dioxide, and water in photosynthesis.
    13·1 answer
  • Robert hooke coined the term cell when studying thin slices of cork. These ________ were the first cells observed because ______
    9·1 answer
  • In which structure would you find a nucleus
    12·2 answers
  • Many biotic factors affect individuals in a population. An example of an organism being directly affected by a biotic factor is
    14·1 answer
  • Help me full in the blank for number 3 please
    5·1 answer
  • cellular respiration occurs in which three stages? light reaction, dark reaction, atp production glycolysis, krebs cycle, electr
    8·2 answers
  • The use of DDT as a pesticide is an example of how new technology can have favorable an dangerous long-term outcomes.how does th
    15·2 answers
  • 30 POINTS HELP ASAP! WRITE IN YOUR OWN WORDS!!! I WILL MARK BRAINLIEST HELP PLEASE ITS DUE TODAY AND I REALLY NEED TO GET IT DON
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!