1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
4 years ago
10

Deforestation is a major environmental issue in what three nations?

Geography
2 answers:
AVprozaik [17]4 years ago
8 0

Answer:

Nigeria, Ghana and Philippines are the three nations where deforestation is a major environmental issue.

Explanation:

  • Deforestation is the transformation of forested land into non-forested land by the process of cutting trees or burning the entire forest.
  • This removal or destruction has significant results where the forest cover is removed has resulted in environmental degradation with reduced Bio-diversity.
  • Deforestation greatly contributed to greenhouse gas as a result increase in the earth's temperature.

katen-ka-za [31]4 years ago
4 0

<span>I found these studies about d</span>eforestation in 2009<span>, 2/3 of the world forests were in 3 top countries: 1) </span>Russia<span>, 2) </span>Brazil<span>, 3) </span>Canada
You might be interested in
These pictures illustrate how the diffusion of American culture has resulted in -
maria [59]
I say the answer is a J
5 0
3 years ago
What type of economic activity would an accountant be considered?
Nata [24]
It’s would be B( the 2nd one).
3 0
3 years ago
Four items are affected by a change in temperature. Which one of the following results as a chemical change?
PSYCHO15rus [73]

Answer:

not sure

Explanation:

I believe a chermical reaction

3 0
3 years ago
Three words that describe communism
Leokris [45]

Answer:

Common

Usual

Universal

Explanation:

Please mark branliest if this helped ;)

5 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What do cultural landscape elements you observed tell us about the culture in our community?
    8·1 answer
  • Please help me with this<br> giving 50 points<br> and brainlest
    13·2 answers
  • Today, the greatest number of urban dwellers is found in
    9·2 answers
  • Explain why three coplanar lines may have zero, one, two, or three points of intersection?
    6·1 answer
  • Mohandas Gandhi adopted his creed of nonviolence and respect for life from the religious doctrines of
    10·2 answers
  • CULLULUI
    7·1 answer
  • Which does not occur at the continental margin in the Pacific Ocean?
    12·2 answers
  • The type of earthquake wave that “shakes” the particles at right angles to the direction it is traveling is the ________________
    14·1 answer
  • What is the science ibn al haytham was famuos for​
    6·1 answer
  • Explain how Africa's natural resources have had a negative impact on the country's development.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!