1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EastWind [94]
3 years ago
14

When a physical change in a sample occurs which of the following does not change

Biology
1 answer:
SashulF [63]3 years ago
4 0

Composition does not change

Explanation:

When a physical change occurs in a sample, the composition does not change. Physical change is a change that only alters the physical properties of matter.

  • In physical change, matter only mixes with one another.
  • The composition remains the same.
  • No new compounds are formed as bonds in compounds are not broken or rearranged.
  • The change is easily reversible.

Learn more:

Physical change brainly.com/question/10972073

#learnwithBrainly

You might be interested in
Help me please, it’s due tomorrow
NeTakaya
Sorry I don’t know but good luck
3 0
3 years ago
28 POINTS!!!
Lubov Fominskaja [6]
I believe the correct answer is theory
8 0
3 years ago
Read 2 more answers
What does the tilde symbol mean in biology
dangina [55]

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

6 0
3 years ago
This phase is known as _____<br><br> p
MAXImum [283]

Answer:

phillip?

Explanation:

8 0
3 years ago
Read 2 more answers
Why are steroids important to life?
lina2011 [118]
Steroids are naturally occurring as sterols, adrenal, sex hormones, some vitamins and make up most drugs as synthetic steroids.

Types Of Steroids and Their Functions
1. Anabolic Steroids
-increase muscle mass
-promote cell growth and division
-testosterone( natural anabolic steroid) is used in sperm production, development of male reproductive organs and emergence of male secondary sexual characteristics.
-stimulates bone and muscle growth.

2. Sex Hormones
-produced by adrenal cortex
-aid in development of gametes
-prepare females for pregnancy, menstruation

OTHER
-enable longer athletic sessions
-increase protein synthesis
-Anti-inflammatory steroids can reduce swelling, pain and other manifestations of inflammation

4 0
3 years ago
Other questions:
  • What name is given to substances that resist changes in ph? buffers sugars bases salts?
    9·1 answer
  • Which of the following is a product of photosynthesis?
    14·2 answers
  • The primary function of the cell wall is to
    12·1 answer
  • O que representa o ciclo de Calvin?
    13·2 answers
  • Is there any reason that meiosis could not occur in an organism whose genome is always haploid?
    9·1 answer
  • Some single-celled organisms make copies of themselves through mitosis. Which decribes the function of the cell cycle in such si
    5·1 answer
  • You have a sealed glass jar full of air. If you put it in the freezer, what happens to the gas pressure in the jar?
    13·1 answer
  • 14. Alleles can be described as I. dominant II. recessive III. codominant IV. partially dominant V. incompletely dominant II, II
    15·1 answer
  • The image depicts the anatomical structure of the forelimb of a dolphin and a bat, both mammals. Which hypotheses are consistent
    6·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!