1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
11

Building a Macromolecule Virtual Lab Instructions: Complete the Building a Macromolecule Virtual Lab from the lesson assessment

page. Select begin and follow the instructions to complete the lab report. Title: Objective(s): Construct an Explanation: Construct an explanation using what you learned in the lesson. How are larger macromolecules formed from atoms of smaller macromolecules?
Biology
2 answers:
yawa3891 [41]3 years ago
6 0

Answer:

By bonding with each other.

Explanation:

Larger macromolecules are formed from smaller macromolecules by making bonds with each other. carbohydrate is a macromolecule which is formed from glucose which is a micromolecule. Proteins is also a macromolecule composed from amino acids while lipid is also a macromolecule that are formed from fatty acids. These small micromolecules join together forming covalent bonds with each other.

Bumek [7]3 years ago
4 0

Answer:

By bonding with each other.

Explanation:

Larger macromolecules are formed from smaller macromolecules by making bonds with each other. carbohydrate is a macromolecule which is formed from glucose which is a micromolecule. Proteins is also a macromolecule composed from amino acids while lipid is also a macromolecule that are formed from fatty acids. These small micromolecules join together forming covalent bonds with each other.

You might be interested in
How is the energy produced by respiration stored? (Googled answers will be reported) (actual answers please)
sergeinik [125]

Answer: Energy is produced by respiration because its stored within the cells in the form of ATP (Adenosine Triphosphate) .

Explanation:

I'm pretty sure that's it.

- Sorry if I'm wrong :<

7 0
3 years ago
What is the importance of the amniotic egg?
Alja [10]

Answer: The amniotic egg was an evolutionary invention that allowed the first reptiles to colonize dry land more than 300 million years ago. Fishes and amphibians must lay their eggs in water and therefore cannot live far from water. But thanks to the amniotic egg, reptiles can lay their eggs nearly anywhere on dry land.

Explanation:

7 0
3 years ago
Read 2 more answers
In what region of the United States did most of the battles shown on the map occur?
Alexeev081 [22]

Answer:you

Explanation:ypu

7 0
3 years ago
In this figure, a line through points X and Y will
Naddika [18.5K]

A picture is needed to answer.

7 0
3 years ago
How does the rules of atoms apply to the conservation of mass?
Alchen [17]

Answer:

The Law of Conservation of Mass tells us that matter is neither created nor destroyed during a chemical reaction. Atoms can be rearranged to form new compounds, but the total mass of the system remains constant.

6 0
3 years ago
Other questions:
  • Frozen water (ice) has less density than liquid water.
    6·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Question 16
    12·1 answer
  • Which factor is a characteristic of an acid?
    11·1 answer
  • Why are your chromosomes arranged in pairs
    14·1 answer
  • Help pls sombody?????????
    11·2 answers
  • All materials have distinct properties that need to be considered in the design process.
    5·1 answer
  • How do organisms reproduce asexually
    11·1 answer
  • HELP!!!
    7·1 answer
  • If you’re looking at tissue samples, how can you determine if there is cancer? What are some visual differences?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!