1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Colt1911 [192]
3 years ago
11

If the beetles survive by consuming cycad pollen, then whether the beetles should be considered mutualists with, or parasites of

, the cycads depends upon A) the extent to which their overall activities affect cycad reproduction. B) the extent to which the beetles are affected by the neurotoxins. C) the extent to which the beetles damage the cycad flowers. D) the distance the beetles must travel between cycad microsporophylls and cycad megasporophylls
Biology
1 answer:
tigry1 [53]3 years ago
4 0

Answer:

A

Explanation:

A) The extent to which their overall activities afdect cycad flowers.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
We breathe more quickly and deeply when we exercise. Why does this make sense? Select all that apply. a) Because when we exercis
storchak [24]

Answer:

a) Because when we exercise, we hydrolyze more ATP to ADP and Pi, and O2 is necessary for the hydrolysis, so we increase our intake of oxygen.

c) Because when we exercise, we produce more CO2 and increased ventilation is necessary to rid ourselves of CO2.

d) Because when we exercise, we use more ATP, and additional O2 is necessary to generate sufficient ATP.

Explanation:

During exercise , our body needs more energy in the form of ATP. This ATP comes from break down of food materials in the mitochondria of the cell during cellular respiration. With the addition of oxygen, more ATP is produced during respiration and this ATP is used by the body. With ATP, carbon dioxide is produced as a waste material which can be removed by exhaled out during breathing.

8 0
3 years ago
What is most likely resource to be found near the base of a volcano on earth’s surface?
drek231 [11]
Something very useful and widely used from a volcano is the Basalt fibre because it has the advantage of good combination properties. It is aplied in fire-fighting, environment protection, aviation, the arms industry, atomobile and plastics and even in the construction industry




5 0
3 years ago
How would you account for the fact that fossils of fish are not present in the older layers of rock?
Mademuasel [1]

Answer:

The fish did not yet exist when the old layers of rocks were deposited. In fact, animals with hard parts did not evolve until about 600 million years ago, which is only about 13% of the 4.5 billion year age of the Earth. Multicellular animals without hard parts left tracks in older sediments, but had no fossilize-able body parts.

Explanation:

5 0
3 years ago
In terms of alternation of generations, the internal parts of the pollen grains of seed-producing plants are most similar to a _
Ket [755]

The correct answer is D) fern gametophyte bearing only antheridia.

8 0
3 years ago
Other questions:
  • This is an illness caused by rhinoviruses, that is spread by direct or droplet contact. Symptoms may include mucus build-up, sne
    8·1 answer
  • Parts that carry out specific jobs within a cell are
    15·1 answer
  • In which way does peroxisomal protein import differ from mitochondrial protein import?
    7·1 answer
  • Which of the following is not a type of adaptation?
    12·1 answer
  • Which best describes how the fossil record supports the theory of evolution?
    9·1 answer
  • Plants release oxygen into the
    8·2 answers
  • Which of the following statements would change this into a true statement: "Most, but not all, living organisms are made up of o
    15·2 answers
  • Which process is the main source of movement
    10·2 answers
  • Por qué algunos fosiles son similares a especies actuales
    11·1 answer
  • arrange the organisms from fastest to slowest based on the the time theyd take to complete the 20th carnegie stage
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!