1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikitich [7]
3 years ago
11

How many amino acids do we have in our bodies?

Biology
1 answer:
olga_2 [115]3 years ago
3 0
We have 20 different amino acids in our bodies.
You might be interested in
What occurs during the tetrad formation?
Elis [28]

Answer:

The tetrad occurs during the first phase of meiosis. It is the foursome of chromatids that forms when replicated homologous chromosomes align. It must be formed for crossing over to occur. It is broken apart when the homologous chromosomes separate in meiosis I.

Explanation: Hope this help (MARK BRAINLIEST)

4 0
4 years ago
consider the two individuals that have the following genotypes: CCDd and Ccdd. Predict the outcomes of a cross for these two ind
Agata [3.3K]

Answer:

CCDd 25%

CCdd 25%

CcDd 25%

Ccdd 25%

Explanation:

5 0
2 years ago
The 2 kinds of glaciers are called a. continental, valley c. till and kettle b. continent, mountain d. plucking and moraine
sashaice [31]
Continental, valley. plucking and moraine
3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
PLEASE HELP
mylen [45]

Answer:

Carbon film is when living thing turned to rock.

petrified fossil is the detail left after an organism decays

Explanation:

Petrified fossils is form when minerals replace the structure of an organism.

Carbon film is a type of fossil found in any rock when organic material is compressed.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Glycoproteins contain the steroid ____ to make membranes more flexible ​
    6·1 answer
  • What is a something that all organisms need to be able to do in order to live?
    5·2 answers
  • Berko, who works as a sales executive at ABZ Pharmaceuticals, has proved to be one of the best sales representatives in his team
    12·1 answer
  • Gazelles are adapted to run very quickly over large expanses of open land because they live in areas without many trees. They al
    14·1 answer
  • Which of the following is a biotic factor?
    5·2 answers
  • What property of water allows the<br> oceans’ water to store carbon dioxide?
    11·1 answer
  • objects and conditions that are moving are easier to observe, because our senses are especially good at noticing changes in our
    14·1 answer
  • HT217 Balancing Greenhouse Micronutrients
    13·1 answer
  • Nondisjunction results in gametes that violate which principle?.
    10·1 answer
  • True or false? An organism that is better suited to the environment is more likely
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!