1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
3 years ago
7

13. The middle layer in the American court system is made up of

Law
1 answer:
galben [10]3 years ago
8 0
It is made up of the Appellate courts
You might be interested in
Interest groups often use __________ to influence members of Congress.
Elodia [21]

Interest groups often use lobbying to influence members of Congress.

Explanation:

Interests groups often employ lobbying as a tactic to influence decisions of the executive or the legislature or the judiciary to make sure that the policies being made and the laws that are being passed are in their favor either strategically or economically.

Lobbying groups like big pharmaceuticals often have great influence on how laws are made and which things are outlawed or not as many people in the government also have vested interests in these groups.

7 0
3 years ago
15 points to whoever answers this :D
Leviafan [203]

Answer:

Revised the three strikes law to impose life sentence only when the new felony conviction is "serious or violent."

Explanation:

Proposition 36 modified elements of California's "Three Strikes" Law, which was approved by the state's voters in 1994. In 2004, voters rejected Proposition 66, which like the 2012 measure was an attempt to change some aspects of the original "Three Strikes" Law.

4 0
4 years ago
Which of the following is an example of a tax? cash payment line of credit Medicare
Angelina_Jolie [31]

Answer: A. Medicare

Example - the anwser is A my human friend

8 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Driver _______ are strongly held beliefs, morals or ethical philosophies.
katrin [286]
Answer: Values

Explanation: Driver beliefs are the same thing as driver values, since beliefs and values hold the same meaning as they are “strongly held beliefs, morals or ethic philosophies”.

Hope this helps! Sorry if it is wrong!
6 0
2 years ago
Other questions:
  • 1606 divided by 7 with work
    15·1 answer
  • You are a person who feels that the most important constitutional principles are the
    13·1 answer
  • Discuss the claim that foreign policy and domestic policy are two faces of the same coin. give me full answers.​
    15·1 answer
  • 1 point
    11·1 answer
  • What do you know about the bill of rights .( five sentence ).
    7·2 answers
  • The judicial branch has the responsibility to:
    7·2 answers
  • HAMSTER ON A PIANO DONT ANSWER THIS PLEASE
    10·2 answers
  • This ones really confusing me whos more suspicions Steve or Alex from mine and craft
    14·1 answer
  • Do you think capital punishment should be a viable sentencing option for heinous crimes
    6·1 answer
  • PLEASE HELP!!!!!!!! Im not sure if its A. Please tell the right answer and no fake answers please! Thanks!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!