1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
diamong [38]
3 years ago
12

A switch that has two throws and switches only one wire is known as a(n) A. SPDT. B. SPST. C. TPDT. D. DPDT.

Law
1 answer:
Allisa [31]3 years ago
8 0

Answer:

The correct answer is A. SPDT.

Explanation:

Let's recall that switches can be Single Pole (SP) or Double Pole (DP) depending on the number of electrical circuits controlled. In this case, it's just one and in consequence it's a SP.

Regarding the number of throws, ST switches close a circuit at only one position while DT switches close a circuit in the Up position, as well as the Down position (On-On). Our switch has two throws and it's DT.

<u>The correct answer is A. SPDT. </u>

You might be interested in
The supreme court case worcester v. Georgia was a small victory for the cherokee nation in georgia because it
Blababa [14]

Answer:

The Case of the Supreme Court Worcester v. Georgia was a small victory for the Cherokee nation in Georgia because it was decided that Georgia laws did not apply to Cherokee territory.

Explanation:

In the Worcester case v. Georgia, the Supreme Court denied Georgia jurisdiction and state authority over the Cherokee community. In other words, this meant that Georgia law and authority did not apply to Cherokee territory. Although this decision was a small victory for the Cherokee people, the decision was not very helpful as the state of Georgia totally ignored the Supreme Court decision and forced the Cherokee community to march west.

6 0
3 years ago
based on exit poll data, most American voters are well informed about candidates on the ballot and their policy positions true o
Alex
True most Americans are informed about candidates on the ballot
3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Question 2 of 10
tino4ka555 [31]

The use of information to falsely accuse a company such as it occurred when XYZ ran a story that was not related to the restaurant they wanted to accuse is an example of False light (option D)

The false light is:

  • A grievance of the laws of the United States that refers to defamation.
  • They include a person's right to protection against false publicity to the public.
  • This right must be in balance with freedom of expression

According to the above, in the situation, the cable channel XYZ incurred false light because they showed a video of a restaurant chain different from the restaurant chain in which there was an outbreak of E. coli.

Therefore, the chain of restaurants in the video would be affected by defamation because it did not correspond to the case of the E. coli outbreak. So the correct answer is D. False light.

Learn more in: brainly.com/question/8512832

8 0
2 years ago
Read 2 more answers
Please answer the question in a few sentences... I will mark you brainliest
NemiM [27]
The obligation of a medical coder to keep patients' medical information confidential is an example of the of ethics. __theory a) duty b) virtue confidentiality consequentialist
3 0
3 years ago
Other questions:
  • What are the purposes of political parties? Please give an example
    9·1 answer
  • Which of the following would be considered a responsibility rather than a duty of citizenship at the local level?
    10·1 answer
  • Why are sovereignty, legitimacy and jurisdiction important in a successful government?
    13·1 answer
  • Margot is from Ireland. She has lived
    7·2 answers
  • Which statement is NOT correct regarding the arrest of suspects?
    14·1 answer
  • El radio atomico del elemento oxigeno es de 140 pacometros, ¿cuantos nanómetros equivale?
    13·1 answer
  • Do you watch the news? Do you think the media tells the truth? Why is the news mostly negative?
    13·2 answers
  • If you answer this your a simp for life
    8·2 answers
  • 10. Which of the following is a true statement about the crime of incitement to commit genocide?
    10·1 answer
  • 3. How does the Criminal Justice and Forensic Science Reform Act propose to combat the problems with
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!