1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
14

Where do the respiratory and circulatory systems meet?

Biology
2 answers:
LenKa [72]3 years ago
4 0
The respiratory and circulatory systems meet in the lungs so the answer would be C.
zlopas [31]3 years ago
3 0

Answer:

Option C. The lungs.

Explanation:

Alveolis are the air sacs in the lungs which main function is to get oxygen into your bloodstream and carbon dioxide leaves the blood.

The alveolis are located in the lungs, and it's where the respiratory and circulatory systems meet, for the reasons stated before.

Therefore, the correct option is Option C.

You might be interested in
There are two main process involved in producing a protein molecule from the information in DNA.
Radda [10]

Answer:

which website is this from ?

Explanation:

8 0
3 years ago
Read 2 more answers
"Twice the protein!" Have you seen this advertising slogan for Greek yogurt and some nutritional sports products? Do we really n
Arlecino [84]

Answer:

A. 60 grams protein

B. 74 grams of protein

Explanation:

The amount of protein needed depends on weight and lifestyle. The daily minimum recommended by the National Institutes of Health is 0.36 grams per pound for a sedentary person. But the daily optimal intake for this same sedentary person is 0,8 grams of protein per kg of body weight. On the other hand hand, adults with a more active lifestyle need more protein in their body, the intake should be between 1,2 and 2,0 grams of protein per kg. For example, endurance runners need up to 1,4 and strength training athletes need up to 1.8 g of protein per kg.

The first step for calculating protein requirements is calculate the weight in kilograms, so we need to divide the weight in pounds by 2,2.

154lb/2,2= 70 kilograms

Then we have to multiply the weight in kg, times the number of protein needed per day, 0,8 for a sedentary healthy adult.

70kg x 0,8= 56 grams

Part A:

165-pound (lb) male who is healthy but sedentary

165 lb/2.2 = 75 kg

75 kg x 0,8 = 60 grams protein per day

Part B. Sarah is moderately active so we need to use a number between 1,2 and 2, since shes active but not very active we can use the 1,2.

136-lb/2,2= 62 kg

62 kg x 1,2 = 74 grams of protein

7 0
3 years ago
How do scrubbers reduce the impact of coal use?
elena55 [62]
<span>How do scrubbers reduce the impact of coal use?
a.
Scrubbers remove all harmful emissions from smoke before it leaves the plant.
b.
Scrubbers remove nearly all carbon dioxide from smoke of coal power plants.
c.
Scrubbers remove sulfur from the smoke of coal power plants.
d.
Scrubbers remove large particulates from the smoke of coal power plants.</span>

<span>
</span>

<span>>>THE ANSWER WOULD BE C<<</span>

<span>c.Scrubbers remove sulfur from the smoke of coal power plants.</span>

8 0
4 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Which statements describe Newton and the law of universal gravitation? Check all that apply
marissa [1.9K]

Newton's law of universal gravitation states that any two bodies in the universe attract each other with a force directly proportional to the product of their masses and inversely proportional to the square of the distance between them.

8 0
3 years ago
Read 2 more answers
Other questions:
  • True or false: channel proteins and carrier proteins are both transport proteins
    6·2 answers
  • Describe the 2 divisions of the Circulatory System, and discuss the components of each.
    6·1 answer
  • Chromosomes from the mother control whether a child is male or female. true or false.
    6·1 answer
  • Identify the following terms associated with the water cycle.
    6·2 answers
  • What would be the best way to investigate his question?
    11·1 answer
  • How the leaves adapted their function​
    15·2 answers
  • Two scientists did the same experiment but arrived at different results. The scientists most likely
    11·2 answers
  • Why is it important to include units with your temperature measurements?
    12·1 answer
  • Name 1 body system (NOT the digestive
    9·1 answer
  • What is the benefit of this complementary nature of DNA?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!