1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
10

An increase in the biodiversity of an ecosystem leads to an increase in its productivity T or F

Biology
2 answers:
luda_lava [24]3 years ago
5 0
The answer to this is i think True
Artyom0805 [142]3 years ago
5 0
The correct answer is True!
You might be interested in
Describe how a zygote with trisomy 21 is likely to<br> occur during fertilization.
maks197457 [2]

Answer:

If the paired chromosomes fail to separate during meiosis in the female, then the resulting daughter cells will receive either 2 or no copies of chromosome 21. If the resulting egg with 2 copies of chromosome 21 is fertilized with a normal sperm, the resulting zygote with be trisomy 21

Explanation:

5 0
2 years ago
Describe one way in which ribosomes interact with organelles. How would having a larger number of ribosomes benefit a cell? In y
tino4ka555 [31]

Answer:

Ribosomes are the machinery of protein synthesis in the cell. They are associated with different organelle of the cell. They are also found free-floating in the cytoplasm of the cell.

The organelle which ribosomes interact are plasma membrane in prokaryotes and endoplasmic reticulum(ER) in eukaryotic cell. Ribosomes are present on the surface of the ER and helps in protein synthesis in the ER. In prokaryotes, there is no ER so it is associated with plasma membrane and perform protein synthesis.

The specialized function of ribosome is to perform protein synthesis and these proteins are necessary for cell because protein are important to make enzymes that regulate the metabolism of the cell. So if protein synthesis stops cell will not able to perform important metabolic activities to survive and it will die.

Having a large number of ribosomes benefits cells because it fastens the protein synthesis process in the cell. So large amount of protein can be produced in less time.

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Extra-solar planets are probably composed of which gases? Select all that apply.
kherson [118]

Answer:

Hydrogen and helium.

Explanation:

Extrasolar planets, also called exoplanets are the planets that are placed out of the solar system and it orbits around another star, not the Sun. The planets that are not orbiting around the Sun are made of two easiest elements, and those elements are hydrogen and helium. Extrasolar planets are very strange objects that are not even close to looking like Earth.

6 0
3 years ago
Which best explains why sawdust burns more quickly than a block of wood of equal mass under the same conditions?
e-lub [12.9K]

Answer:

Particles need to collide in order to react. Which best explains why sawdust burns more quickly than a block of wood of equal mass under the same conditions? The molecules move more quickly in the sawdust than in the block of wood. The pressure of oxygen is greater on the sawdust.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What organelle gives plants the structure they need to stand up tall.
    14·2 answers
  • How many times stronger the signal for the carbon than the signal for nitrogen?
    5·1 answer
  • An organism's potential to produce disease in a person depends on four factors: the number of organisms, the person's immune sys
    5·1 answer
  • With sympatric speciation a physical barrier arises and separates two populations ending gene flow between them.
    14·1 answer
  • The accuumulation of sediment found along a lake or a ocean
    6·1 answer
  • How do you think the rabbit population affected the fox population over the same ten-year period?
    13·2 answers
  • This term is used to describe the physical appearance of an organism based on their genetics.
    12·1 answer
  • Who created the naming system
    5·2 answers
  • Plants get the energy they need for photosynthesis by absorbing sugars<br><br> true<br> false
    13·1 answer
  • Anika's dream job is to work as a scientist for NASA. Which education path will help her achieve her goal?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!