1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesya692 [45]
4 years ago
15

Student argues that being separated geographically is the only way for speciation to occur. Why is he wrong?

Biology
2 answers:
solniwko [45]4 years ago
6 0

Answer:

its B

Explanation:

Ne4ueva [31]4 years ago
5 0

Answer:

its b

Explanation:

edgenuity 2020

You might be interested in
1) After watching the video “How wolves change rivers”, in 2 - 4 sentences explain how human activity changed Yellowstone Nation
Pavel [41]

Answer:

Human interaction with the ecosystem has rapidly spread disease to Yellowstone's wildlife, which has proven to have adverse effects on populations. Also, humans tend to leave trash in poor areas. Littering is a problem in Yellowstone because it can be ingested by the wildlife and also pollute the park.

Explanation:

6 0
3 years ago
Identify the area on the image where the force of attraction is the strongest.
zhuklara [117]
1st image has more strongest attraction because opposite forces attract i.e. soth and north attract..where as in 2nd pic north -north pole repel
6 0
3 years ago
What are the two principal types of connective tissue in a muscle? collagen and myofibrils myofibrils and elastin myofibrils and
kirza4 [7]

The two principal types of connective tissue in a muscle are collagen and myofibrils. The entire muscle is wrapped in collagen to form a fascicle. Looking at one muscle fiber, you will see that almost the entire cross section of the muscle fiber is composed of long, cylindrical strands of proteins called myofibrils<span>. </span>

4 0
3 years ago
Choose two organisms: one sexual reproducer and one asexual reproducer. For each organism, discuss the following
Iteru [2.4K]
An example of an asexual organism can be jellyfish or corals, they release there eggs and sperm into the water where they combine and grow on their own. Research the details, many diagrams.
4 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • Pubic hair, breasts, facial hair, and deepening of the voice are called _____.
    14·2 answers
  • Describe factors that have played a role in how humans have altered the environment.
    14·1 answer
  • Which example correctly describes the relationship of form and function at the chemical level?
    5·1 answer
  • After chromosomes align, what happens next?
    10·1 answer
  • If a woman starts ovulating at 13 and stops at 50; a) how many ova are likely to be released from her ovaries? b) about how many
    8·1 answer
  • A brown bird was crossed with a white one and all of the offspring were tan. Complete a Punnett Square analysis for this pair to
    7·1 answer
  • Plant and animal cells make exact copies through the process of
    5·2 answers
  • The scale of a road map indicates that 4 cm is equal to 30 km. Calculate the distance in km between two cities if the road betwe
    13·1 answer
  • Although all of the cells of a human develop from one fertilized egg, the human is born with many
    6·1 answer
  • How many naturally occurring amino acids are there.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!