1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
2 years ago
15

List the layers contained in the atmosphere and describe what is in each layer.

Biology
1 answer:
lisabon 2012 [21]2 years ago
7 0

Answer:

Exosphere -The exosphere layer is mainly composed of extremely low densities of hydrogen, helium, and several heavier molecules including nitrogen, oxygen, and carbon dioxide closer to the exobase. The atoms and molecules are so far apart that they can travel hundreds of kilometers without colliding with one another.

Thermosphere - The aurora (Northern Lights and Southern Lights) mostly occur in the thermosphere. The thermosphere is a layer of Earth's atmosphere. The thermosphere is directly above the mesosphere and below the exosphere. ... Temperatures in the upper thermosphere can range from about 500° C (932° F) to 2,000° C (3,632° F) or higher.

Mesosphere- Most meteors burn up in the mesosphere. A type of lightning called sprites sometimes appears in the mesosphere above thunderstorms. Strange, high-altitude clouds called noctilucent clouds sometimes form in this layer near the North and South Poles.

Stratosphere-The stratosphere is the second major atmospheric layer above the troposphere, extending in altitude from about 8 to 30 miles high. No weather occurs in the stratosphere. The statosphere contains over 15% of the total mass of the atmosphere, and is where the ozone layer is located.

Troposphere-The troposphere is the lowest layer of Earth's atmosphere, and is also where nearly all weather conditions take place. It contains 75% of the atmosphere's mass and 99% of the total mass of water vapour and aerosols.

i hope this helps, good luck :)

You might be interested in
Which of the following options describes a morula? THANKS FOR THE HELP!
stiv31 [10]

Answer:

A

Explanation:

4 0
2 years ago
The major source of the genetic diversity among microorganisms upon which natural selection operates is
GarryVolchara [31]

What is Mutation

The major source of the genetic diversity among microorganisms upon which natural selection operates is Mutation.

Hope this help

plz mark brainliest

HAVE A NICE DAY!!!

8 0
2 years ago
Read 2 more answers
In fast-twitch oxidative-glycolytic fibers, their rapid increases in force rely on the ________ activity where rapid relaxation
Kitty [74]

Answer:

1. myosin ATPase

2. Ca2+-ATPase

Explanation:

ATPase activity of myosin head hydrolysis ATP and energize the myosin head. The energized myosin head forms cross bridges to facilitate the power stroke of muscle contraction. The fast-twitch oxidative-glycolytic fibers have the ability to produce ATP by aerobic respiration.  

These fibers have the  ATPase in their myosin heads that hydrolyze ATP three to five times faster than the myosin ATPase in slow fibers. This ensures the faster speed of contraction of these fast-twitch muscle fibers.

During their relaxation, Ca2+ ATPase pumps the calcium ions back to the sarcoplasmic reticulum. As the level of Ca2+ ions in the sarcoplasm decreases, calcium ions are released from troponin. Tropomyosin is allowed to cover the myosin-binding sites on actin and the muscle fiber relaxes faster.

4 0
2 years ago
The photographs of the crime scene should all be close-ups of
GenaCL600 [577]

Answer:

false

Explanation:

5 0
2 years ago
Read 2 more answers
Examine the f1 complex of the atp synthase from bovine heart mitochondria. what prevents this f1 complex from rotating with the
mariarad [96]
By examining the F1 complex of ATP synthase which is from Bovine heart mitochondria. Then we should ask what prevents F1 complex from rotating with Fo c-ring complex?. It is bound to the central stalk. F1 rotates with Fo c-ring complex and nothing prevents it. The mitochondrial membrane is where Fo c-ring is bounded. Stationary "a" subunit of Fo is where the stator which is connected to it bounds. 
In conclusion, we will say that the answer is, it is bounded by the stator, which is corrected to the stationary "a" subunit of Fo.
The ring-shaped C subunits form the rotor of the F1FO complex. FOF1 is bound to the central stalk, Therefore, it prevents it from rotation which is during the translocation of protons
3 0
3 years ago
Other questions:
  • Which of the following about carbohydrates and lipids is true?
    6·1 answer
  • Which of the following is true
    15·1 answer
  • The stereotype image of Neandertal as a "brutish, ignorant caveman" is based on:
    5·1 answer
  • The festival site is the shoreline. What kind of complement is the word in bold? Predicate nominative objective complement direc
    7·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the energy of a photon first used to do in photosynthesis?
    8·1 answer
  • Genetic disorders can result when sister chromatids fail to separate properly. During which phase is this problem most likely to
    13·1 answer
  • How are viruses, bacteria, and parasites alike?
    8·1 answer
  • What type of fingerprint pattern is this?
    10·1 answer
  • Hybrid plants are more likely to be sterile than open-pollinated plants.<br> True<br> False
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!