1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
14

TRUE OR FALSE : Cohesion is when water molecules stick to OTHER substances.

Biology
1 answer:
tekilochka [14]3 years ago
3 0

Answer:

true

Explanation:

Thus when the positive side on one water molecule comes near the negative side of another water molecule, they attract each other and form a bond. This "bipolar" nature of water molecules gives water its cohesive nature, and thus, its stickiness and culpability

You might be interested in
The light-dependent reactions include an electron transport chain system that works in a very
mamaluj [8]

Explanation:

When the high energy electrons move from the reactive center, they are conveyed from one chain protein to another as the energy in the electrons is harnessed to pump H+ ions from the stroma into the lamellae. The electron will ultimately reduce NADP+ to NADPH and the electrons in the reactive center will be replaced by high energy electrons from the splitting of a water molecule in photolysis. The energy of the sun is used to split the water molecule. The high energy electrons then undergo the same cycle as the previous electrons and the cycle continues.

Eventually a proton-motive force is created across the lamellae membrane. This potential energy of the high H+ ion gradient is used by ATP synthase enzyme to phosphorylate ADPs to ATPs.  

Learn More:

For more on photosynthesis check out;

brainly.com/question/12131960

#LearnWithBrainly

3 0
3 years ago
cellular respiration occurs in which three stages? light reaction, dark reaction, atp production glycolysis, krebs cycle, electr
nignag [31]

The answer is ATP production glycolysis, Krebs cycle, and electron transport aerobic in that order. Glycolysis occurs in the cytoplasm while the other two stages occur in the mitochondria (Krebs cycle in the mitochondrial matrix and the electron transport chain in the mitochondria membrane).



The answer is Autotrophs. Examples of autotrophs are plants and photosynthetic bacteria (photoautotrophs). They convert abiotic factors such as light to organic molecules. These also include chemosynthetic bacteria (chemoautotrophs) that elements such as sulfur dioxide and methane in hydrothermal vents to organic molecules.


5 0
3 years ago
Read 2 more answers
Which of the following statements is NOT true about the
joja [24]

Answer:

A) Between nucleotides, the base A will bind to the base G, and the base T will bine to the base C.

Explanation:

bases A and T bind to together, while bases G and C bind together.

(according to studies)

This is why A is the correct answer.

Hope it helps!!(Also, please don't forget to add me as brainiest to support me)

6 0
2 years ago
Identify the features that distinguish animals from organisms in other multicellular kingdoms.
Nata [24]
The features that <span>distinguish animals from organisms in other multicellular kingdoms are that a</span>nimals are ingestive heterotrophs.
7 0
3 years ago
Why is calculating height from bone length useful to a forensic pathologist?
cluponka [151]
<span>By discovering height and length of a bone forensic experts are able </span>to tell the person’s weight, the racial group to which the person belongs. With other characteristics of the bones, the experts can discover age,  if the person was a male or female and what traumas suffered before.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Something characteristic of a survivor in the reconstitution phase of traumatic stress might be to ________.
    11·1 answer
  • Booker has a really bad headache, so he takes a new painkiller. the drug works wonderfully to relieve his headache. the next tim
    14·2 answers
  • Which of the following would decrease the resistance to the flow of an electric current through a body?
    9·2 answers
  • Fur thickness in dogs is inherited due to a single gene with two possible alleles. When two copies of the dominant gene is prese
    11·1 answer
  • Which of these provides evidence from developmental biology of a shared evolutionary history?
    8·2 answers
  • Explain how gravitational force keeps the Earth’s yearly revolution around the Sun consistent.
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • It has been said that the economy of the North would not be nearly as successful as it is without the economic activity of the s
    8·1 answer
  • Select all that apply.
    8·1 answer
  • Sensory _____________ respond to stimuli by sending messages to the brain A. Nerve cells, or __________ , are the basic units of
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!