You would most likely find it in the plants stem.
Answer:
they are Na+, K+ and Ca2+ ion channels.
Explanation:
Ionotropic acetylcholine receptors are also called nicotinic acetylcholine receptors because beside acetylcholine (Ch) they respond to nicotine. These receptors are primary receptors in muscle for motor nerve-muscle communication that controls muscle contraction.
Two molecules of ACh are required for receptor to open. Since the receptors are linked to ion channels, the channels open. Opening of the channel allows positively charged ions to move across it: sodium enters the cell and potassium exits.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Enzymes help speed up chemical reactions in the human body. They bind to molecules and alter them in specific ways. They are essential for respiration, digesting food, muscle and nerve function, among thousands of other roles.
The Miller-Urey experiment showed that simple molecules could have arisen abiotically. This chemical experiment included conditions similar to those present on the early Earth, and tested the origin of life under those conditions.
Water (H2O), methane (CH4), ammonia (NH3) and hydrogen (H2) were the chemicals used to produce the results of the experiment, the factors needed for simple life to arise. Given similar conditions on other planets, it's possible that life could arise there as well.
