1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bumek [7]
3 years ago
5

Carbon monoxide prevents

Biology
2 answers:
Julli [10]3 years ago
4 0

Answer:

Carbon monoxide prevents your body's blood cells from carrying enough oxygen to your body.

Explanation:

Carbon monoxide is a gas produced based on the incomplete burning of carbon-rich fuel material. Despite its applications in the industry, it is a very toxic asphyxiating gas that, depending on the exposure time and the amount inhaled, can lead to death because it prevents the blood cells in your body from carrying enough oxygen to your body.

The main route of intoxication with carbon monoxide is respiratory, which causes CO to reach the lungs quickly and cause intoxication. After inhalation, carbon monoxide is diffused through blood vessels, combining with hemoglobin, responsible for the transport of O2 by the human body, resulting in carboxyhemoglobin.

Carbon monoxide has about 200 times more affinity with hemoglobin than oxygen gas and, by binding to it, decreases the amount of hemoglobin available for the transport of O2 by the human body. This competition with oxygen can lead to death from suffocation.

After inhalation, carbon monoxide can cause mild symptoms of poisoning, headaches and even shortness of breath, leading to death. The symptoms depend on the concentration of CO in the atmospheric air and the time of exposure to the gas. Rapid exposure to gas can lead to fainting, confusion, nausea and headaches. When the inhalation time increases, the symptoms worsen and can cause intoxication of the central nervous system, convulsions, decrease in heart rate and breathing, causing the death of the organism.

Liono4ka [1.6K]3 years ago
3 0

Answer:

oxygen from reaching your tissues and organs.

Explanation:

Carbon Monoxide is very dangerous to us and many other animals. It is a flamable gas that is bad for our blood cells. When we breath it in and it gets put into out blood, it cannot be used as a substitution for air, and you will suffocate.

...I think.

You might be interested in
A hockey puck with a mass of 0.16 kg is sitting at rest on a frozen pond. Suddenly, the wind begins to blow, accelerating the pu
Nadya [2.5K]
The answer is B 100n
7 0
3 years ago
Read 2 more answers
___________ control all chemical reactions including metabolic processes like photosynthesis and cellular respiration
IceJOKER [234]

Answer:

Explanation:

cellular respiration

6 0
2 years ago
1. a diagram that shows the connections among food chains in an ecosystem
Alenkasestr [34]
1. Food web? 2.Habitat 3.Omnivore 4.Primary consumer 5. Producer 6. Secondary consumer
3 0
3 years ago
10. Researchers observe a large population of birds on a remote island. Birds in the population are found to have either red cre
IgorLugansk [536]
Suppose that the proportion of the white crest alleles (r) is given by w and that of the Red crest allele (R) is given by p. We have that p+w=1. The probability that an individual has 2 r alleles is given by w*w since for each allele position the probability is w. Only these individuals have a White phenotype. Hence, we get that w^2=\frac{1759}{1759+11088}; the right hand side is the proportion of white birds in the total population. Doing the calculations, this yields that w=0.37. From this, we calculate that p=0.63. The possible ways we have heterozygous individuals are the combinations Rr and rR. The probability for each of those is p*w. Thus, the total probability is 2pw. This is equal to 0.466=0.47. This is the fraction of the future population that is going to be heterozygous assuming the conditions of the Handy-Weinberg equilibrium like random reproductive matching etc.
7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • Click and drag each word or phrase on the left to complete the sentences on the right. Then click and drag the sentences arrangi
    6·1 answer
  • In a wave, what happens to a molecule after it passes energy on to the next molecule in the chain?
    14·1 answer
  • (WILL MARK BRAINLIEST AND 50pts) As the earth travels around the sun, the sun is always at one focus of an ellipse. What's at th
    8·1 answer
  • Creates and packages proteins
    13·2 answers
  • 1) As algas são seres eucariontes, ______________, fotossintetizantes, dotados de ___________, e podem ser _____________ ou mult
    15·1 answer
  • A Hypertonic solution outside of the cell has how much solute compared to the solution inside of a cell?
    13·1 answer
  • Deninition of Meta-analysis
    9·1 answer
  • Alcohol (ethanol) has a higher specific heat index than water. Based on this information only, what can you conclude? A. The sur
    12·2 answers
  • An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified
    11·1 answer
  • What does it mean To change over a period of time
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!