1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
9

Suppose the students are caught in a sudden storm how can they stay safe during the storm

Biology
1 answer:
PilotLPTM [1.2K]3 years ago
7 0
The Answer to that is they should get to a warm environment and even huddle up together and don't talk and get something warm. <span />
You might be interested in
When arteries become clogged which of the following may result?
Artemon [7]

Blood pressure will increase

Hope this helps!

5 0
3 years ago
Read 2 more answers
The process of DNA replication occurs just before
White raven [17]

Answer:

Explanation:

the process of DNA replication occurs just before the cell division i.e. mitosis. DNA synthesis happens in S-phase i.e. synthesis phase of interphase where cell division preparation happens.

5 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Which is BEST if the writer wants to express that he is able to eat vegetables?
Rina8888 [55]

Answer:

Umm...I'm not sure if this is a question where there is MC but if not, the the answer would most likely be, "By actually doing then saying"

Explanation:

7 0
3 years ago
What is bipedalism? Give one example of an organism with bipedalism
mash [69]

Bipedalism is a form of terrestrial locomotion where an organism moves by means of its two rear limbs or legs. 

(ostrich, human etc. )

5 0
4 years ago
Read 2 more answers
Other questions:
  • Under what circumstances might antibodies not be useful in treating a disease caused by a pathogen?
    6·1 answer
  • What happens during anaphase​
    6·2 answers
  • Water helps regulate body temperature through perspiration and precipitation. true or false giving brainliest to the correct per
    6·2 answers
  • QUE ES ELECTRIZACIÓN​
    11·1 answer
  • 13. (02.05 LC)<br> What are the reactants for cellular respiration? (1 point)
    8·1 answer
  • A student flips a light switch but the light does not turn on. Based on this
    15·2 answers
  • How many of the listed items are elements?
    5·2 answers
  • Does Prader Willi Syndrome have an emotional symptoms?
    14·1 answer
  • AT 8:00 AM you leave home and walk 0.5 km to a friend's house. At 11:30 AM you return home, then travel by car to the mall, whic
    9·1 answer
  • Looking for a good study guide best / quickest gets brainliest
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!