1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
4 years ago
5

Ginkgo trees (Ginkgo biloba) are "living fossils." Although ginkgos are native to China, they now are commonly planted in cities

in the United States. Keeping in mind the principles of allopatric speciation, what might happen over time to the two populations of ginkgos?
Biology
1 answer:
Svetllana [295]4 years ago
4 0

Answer:

The two populations might become separate species

Explanation:

Allopatric speciation is one of the mechanisms that can lead to the establishment of a new species of organisms as a result of geographical separation of different population of organisms of the same species.

<em>When organisms of the same species are geographically separated, this prevents gene flow between the two populations and each population develops various adaptive features in order to cope with their environments. Thus, each population might end up becoming a new species.</em>

You might be interested in
What do u mean by unit cell and crystal lattice.
mafiozo [28]
Unit cell: The simplest arrangement of atoms or molecules that regularly repeat in a crystal structure

Crystal lattice: A crystal lattice is a three dimensional atomic structure for the solid phase of matter.

Characteristics of a crystal lattice include
Symmetrical and infinitely repeating arrangement of atoms

hope this helps
5 0
4 years ago
Does high temperature increase or decrease water supply?
inysia [295]

Answer:

is one hundred percent sure

3 0
4 years ago
How do the skin proteins—keratin, melanin, elastin, and collagen—each contribute to our physical identity? how about the dermal
cupoosta [38]
Keratin is responsible for skin color. The more the melanin in the skin, the darker the skin color of the person. Collagen and keratin makes up nails and hairs. Elastin is a connective tissue that connects the epidermis and the dermis. The dermal papillae nourishes the root hairs.
8 0
3 years ago
Read 2 more answers
5 different dental offices and their functions?
Savatey [412]

Dental clinics focus on patient education to prevent disease and provide treatment options for the same procedures offered in general and (some) specialty practices. A clinic houses all dental equipment and tools in one place and is staffed by dentists, dental specialists, dental assistants, and dental hygienists.

4 0
2 years ago
Which of the following human activities would be expected to be the biggest contributor to air pollution? a. driving b. restaura
Ulleksa [173]
A. driving. A single instance of a nuclear weapon would cause more pollution than a single instance of driving, but while millions of cars drive everyday, nuclear weapons are very rarely detonated. All the cars in the world contribute the most to pollution, especially because some countries still don't regulate the pollutants in exhaust.
4 0
4 years ago
Read 2 more answers
Other questions:
  • What is the basic unit of matter A.atomB.bacteriumC.cellD.molecule
    6·2 answers
  • Which of the choices below is not a mechanism of heat production?
    7·1 answer
  • A scientific theory _____.
    8·2 answers
  • Why is glycolysis considered an anaerobic process, but the electron transport chain is not
    5·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Many scientists are begging for governments and people to create sanctuaries
    12·1 answer
  • Green algae are often found in cell colonies. <br><br><br> True<br> False
    10·1 answer
  • BRAINLIEST IF RIGHT 20+ POINTS
    5·2 answers
  • What are the consequences of overdrawal of water?​
    12·2 answers
  • Identify the location of the majority of triglyceride digestion.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!