1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serg [7]
3 years ago
11

How are scientists trying to get around ethical concerns about the use of embryonic stem cells in research and Medicine?

Biology
1 answer:
Lerok [7]3 years ago
7 0
Because they might be doing something against their religion or faith so they just think about the good they will do
You might be interested in
One of the major advances in brain function in middle childhood is the development of:
vekshin1
<span>The middle childhood is the period between ages 7 and 11.</span>
One of the major advances in brain function in middle childhood is the development of automatization. Children this age can master plenty of skills with a little motivation and a lot of practice.
<span>They also immerse themselves in play and it is important for them to get a lot of healthy, physical activity.</span>
4 0
3 years ago
Clouds form when the water vapor in air condenses as
svlad2 [7]

Answer:

Clouds form when the invisible water vapor in the air condenses into visible water droplets or ice crystals. For this to happen, the parcel of air must be saturated, i.e. unable to hold all the water it contains in vapor form, so it starts to condense into a liquid or solid form.

Explanation:

7 0
2 years ago
Ganymede is one of the many moons of Jupiter. It is nearly spherical in shape. It is larger than the planet Mercury and slightly
Volgvan
<span>It moves in an orbit around Jupiter.</span>
6 0
3 years ago
Read 2 more answers
What was the purpose of Project Mercury?
AleksAgata [21]
The goal was to orbit a spacecraft around the Earth. It has people in it. So the answer is B.
8 0
3 years ago
Examine the diagram of a cell.<br> Which accurately labels the Golgi body?<br> W<br> w<br> YN
yaroslaw [1]

Answer:

it is w

Explanation:

i have done a similar question

8 0
3 years ago
Read 2 more answers
Other questions:
  • Please help
    15·1 answer
  • What is the difference in the amount of a molecule through a space
    7·1 answer
  • What is the difference between 'glycogen' , 'glucagon' and 'glucose' ?​
    8·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The two basic functions of meiosis are to _____.
    9·1 answer
  • How many pairs of chromosomes are in a body cell of a macaw
    5·1 answer
  • What is the common component of air pollution?
    15·1 answer
  • Which of these is a biotic factor of an ecosystem?
    7·2 answers
  • If two heterozygous tall peap plants are crossed. What is the expected phenotypic outcome for the offspring?
    12·1 answer
  • Please help meeeeeeee
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!